Previous Contig 002589:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN031N08Sequence453002589 (3)pir|E84552|E845521e-09hypothetical protein At2g17470 [imported] - Arabidopsis thaliana>gb:AC007584_153
JMSF008D02Sequence306004959 (2)758002589 (3)gb:AB026658_15173662e-16Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYF24.>gb:AY099663_157
JMSF018H12Sequence504004959 (2)gb:AB026658_15173665e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYF24.>gb:AY099663_157755002589 (3)gb:AB026658_15173661e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYF24.>gb:AY099663_157

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018H12+ AGCAGCAGAAGA
rJMSF008D02+ GAGGAAGTGCATGNAGCAGCAGAAGA
                      ____________________________________________________________
consensus GAGGAAGTGCATGNAGCAGCAGAAGA
 
. : . : . : . : . : . :
rJMSF018H12+ GTTGCAAAAGAAGGTAGACAAGAAATCTTACCTTCTTGTCAATGCTGAAAGCTGGGAAAT
rJMSF008D02+ GTTGCAAAAGAAGGTAGACAAGAAATCTTACCTTCTTGTCAATGCTGAAAGCTGGGAAAT
                      ____________________________________________________________
consensus GTTGCAAAAGAAGGTAGACAAGAAATCTTACCTTCTTGTCAATGCTGAAAGCTGGGAAAT
 
. : . : . : . : . : . :
rJMSF018H12+ TGGTGGGAGGCAACATGCCCAATTCAATGTCCCACAAGAAGTTTTGGCCTTCGACGATGA
rJMSF008D02+ TGGTGGGAGGCAACATGCCCAATTCAATGTCCCACAAGAAGTTTTGGCCTTCGACGATGA
                      ____________________________________________________________
consensus TGGTGGGAGGCAACATGCCCAATTCAATGTCCCACAAGAAGTTTTGGCCTTCGACGATGA
 
. : . : . : . : . : . :
rJMSF018H12+ CACTGACACCACCACCACCACTGACTATCATTTCAAGTCCCTCAGTGAGGCCAAACTCGA
rJMSF008D02+ CACTGACACCACCACCACCACTGACTATCATTTCAAGTCCCTCAGTGAGGCCAAACTCGA
                      ____________________________________________________________
consensus CACTGACACCACCACCACCACTGACTATCATTTCAAGTCCCTCAGTGAGGCCAAACTCGA
 
. : . : . : . : . : . :
rJMSF018H12+ TTTATCCTCCATTCAAATGCCAAGGAGGTGGGATAATGATGGAAACTCTAGTCACAATGC
rJMSF008D02+ TTTATCCTCCATTCAAATGCCAAGGAGGTGGGATAATGATGGAAACTCTAGTCACAATGC
                      ____________________________________________________________
consensus TTTATCCTCCATTCAAATGCCAAGGAGGTGGGATAATGATGGAAACTCTAGTCACAATGC
 
. : . : . : . : . : . :
rJMSF018H12+ ATTAGCAGGAGTCACATCCGAGAACCACGAAACAGCCCCTATGGAACCCGAAGAAGAAGA
rJMSF008D02+ ATTAGCAGGAGTCACATCCGAGAACCACGAAACAGCCCCTATGGAACCCGAAGAAGAAGA
                      ____________________________________________________________
consensus ATTAGCAGGAGTCACATCCGAGAACCACGAAACAGCCCCTATGGAACCCGAAGAAGAAGA
 
. : . : . : . : . : . :
rJMSF018H12+ AGAAGAATCAAGGACATACGAAAATGCCAGTGCCTTATCCTTGGCAACATTCACCTCACT
rJMSF008D02+ AGAAGAATCAAGGACATACGAAAATGCCAGTGCCTTATCCTTGGCAACATTCACCTCACT
JMFN031N08- ATCCTTGGCAACATTCACCTCACT
                      ____________________________________________________________
consensus AGAAGAATCAAGGACATACGAAAATGCCAGTGCCTTATCCTTGGCAACATTCACCTCACT
 
. : . : . : . : . : . :
rJMSF018H12+ ACTCGTCGAATTTGTTGCAAGACTCCAGAACCTTGTTGACGCATTCCAAGAGCTAAGTGA
rJMSF008D02+ ACTCGTCGAATTTGTTGCAAGACTCCAGAACCTTGTTGACGCATTCCAAGAGCTAAGTGA
JMFN031N08- ACTCGTCGAATTTGTTGCAAGACTCCAGAACCTTGTTGACGCATTCCAAGAGCTAAGTAA
                      ____________________________________________________________
consensus ACTCGTCGAATTTGTTGCAAGACTCCAGAACCTTGTTGACGCATTCCAAGAGCTAAGTGA
 
. : . : . : . : . : . :
rJMSF018H12+ AAAAGGCAAGTTTAATGAACCCGTCGAATTACCAGACAAAGATGAGGCAATTGGGTTATG
rJMSF008D02+ AAAAGGCAAGTTTAATGAACCCGTCGAATTACCAGACAAAGATGAGGCAATTGGGTTATG
JMFN031N08- AAAAGGCAAGTTTAATGAACCCGTCGAATTACCAGACAAAGATAAGGCAATTGGGTTATG
                      ____________________________________________________________
consensus AAAAGGCAAGTTTAATGAACCCGTCGAATTACCAGACAAAGATGAGGCAATTGGGTTATG
 
. : . : . : . : . : . :
rJMSF018H12+ GTCCAGGTTGACGCGGTATGTGAAGTTGTGGAGGAAAGATGACAACTTACTAGCTGGAGA
rJMSF008D02+ GTCCAGGTTGACGCGGTATGTGAAGTTGTGGAGGAAAGATGACAACTTACTAGCTGGAGA
JMFN031N08- GTCCAGGTTGACGCGGTATGTGAAGTTGTGGAGGAAAGATGACAACTTACTAGCTGGAGA
                      ____________________________________________________________
consensus GTCCAGGTTGACGCGGTATGTGAAGTTGTGGAGGAAAGATGACAACTTACTAGCTGGAGA
 
. : . : . : . : . : . :
rJMSF018H12+ GAATGCAGTTCGATTGGTGTAGAAGACCATGCTAAGCTATAACTTTGAACACTCATATTG
rJMSF008D02+ GAATGCAGTTCGATTGGTGTAGAAGACCATGCTAAGCTATAACTTTGAACACTCATATTG
JMFN031N08- GAATGCAGTTCGATTGGTGTAGAAGACCATGCTAAGCTATAACTTTGAACACTCATATTG
                      ____________________________________________________________
consensus GAATGCAGTTCGATTGGTGTAGAAGACCATGCTAAGCTATAACTTTGAACACTCATATTG
 
. : . : . : . : . : . :
rJMSF018H12+ GGTGTTTGGCTTTATGGGGATCTTACTCTTAAGCTGTGGAAGTTCTCCACAAGAAGCCCT
rJMSF008D02+ GGTGTTTGGCTTTATGGGGATCTTACTCTTAAGCTGTGGAAGTTCTCCACAAGAAGCCCT
JMFN031N08- GGTGTTTGGCTTTATGGGGATCTTACTCTTAAGCTGTGGAAGTTCTCCACAAGAAGCCCT
                      ____________________________________________________________
consensus GGTGTTTGGCTTTATGGGGATCTTACTCTTAAGCTGTGGAAGTTCTCCACAAGAAGCCCT
 
. : . : . : . : . : . :
rJMSF018H12+ TTTTGCAAGAACACCTGCTTAACATTGCTAGAGTAGTAGA-CAAGATTTTA-CATGTTTA
rJMSF008D02+ TTTTGCAAGAACACCTGCTTAACATTGCTAGAGTAGTAGANCAAGATTTTACCATGTTNA
JMFN031N08- TTTTGCAAGAACACCTGCTTAACATTGCTAGAGTAGTAGA-CAAGATTTTA-CATGTTTA
                      ____________________________________________________________
consensus TTTTGCAAGAACACCTGCTTAACATTGCTAGAGTAGTAGA-CAAGATTTTA-CATGTTTA
 
. : . : . : . : . : . :
rJMSF018H12+ CTAACATATTTA
rJMSF008D02+ CNAACATATTTA
JMFN031N08- CTAACATATTTAGTGGTCTCACGTGTTAAGTACTACTATATATATGGCAATTTAATTTTA
                      ____________________________________________________________
consensus CTAACATATTTAGTGGTCTCACGTGTTAAGTACTACTATATATATGGCAATTTAATTTTA