Previous Contig 002586:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027H15Sequence556002586 (4)pir|T11579|T115792e-50probable short chain alcohol dehydrogenase CPRD12, drought-inducible - cowpea>gb697021277gb:AF286651_17832115e-53Cucumis sativus TASSELSEED2-like protein (CTS2) mRNA, complete cds.
JMFF049J01Sequence644002586 (4)gb:AF286651_17832111e-65Cucumis sativus TASSELSEED2-like protein (CTS2) mRNA, complete cds.
JMFN031F19Sequence141002586 (4)pir|T11579|T115791e-07probable short chain alcohol dehydrogenase CPRD12, drought-inducible - cowpea>gb
JMFN031H17Sequence519002586 (4)pir|T11579|T115795e-31probable short chain alcohol dehydrogenase CPRD12, drought-inducible - cowpea>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049J01+ GACACGCAGTTGACTCGAACTC
                      ____________________________________________________________
consensus GACACGCAGTTGACTCGAACTC
 
. : . : . : . : . : . :
JMFF049J01+ CGTACCGCCCCAGGTCAATCGCCGTGTTCCTCGTAAGCCCCAGCACGCCGTGCTTCGAGC
                      ____________________________________________________________
consensus CGTACCGCCCCAGGTCAATCGCCGTGTTCCTCGTAAGCCCCAGCACGCCGTGCTTCGAGC
 
. : . : . : . : . : . :
JMFF049J01+ TCGTGTACGCGTGCGACGCCACGCCGCCGGTCACGGCGCACACGCTCGCTGTGGTAATTA
JMFF027H15+ ACGCGTGCGACGCCACGCCGCCGGTCACGGCGCACACGCTCGCTGTGGTAATTA
                      ____________________________________________________________
consensus TCGTGTACGCGTGCGACGCCACGCCGCCGGTCACGGCGCACACGCTCGCTGTGGTAATTA
 
. : . : . : . : . : . :
JMFF049J01+ TGCTGCCGCGTCGGTTCGGGACCATCACGCGCGCGGCGTGTTTGGTTCCCAGAAACGCGC
JMFF027H15+ TGCTGCCGCGTCGGTTCGGGACCATCACGCGCGCGGCGTGTTTGGTTCCCAGAAACGCGC
                      ____________________________________________________________
consensus TGCTGCCGCGTCGGTTCGGGACCATCACGCGCGCGGCGTGTTTGGTTCCCAGAAACGCGC
 
. : . : . : . : . : . :
JMFN031F19- CGCGCTCGAAGTTGGATTTCTCGTCGCCCAGGATGCTGG
JMFF049J01+ CGACGAGGTTTACGCCGACGACGCGCTCGAAGTTGGATTTCTCGTCGCCCAGGATGCTGG
JMFF027H15+ CGACGAGGTTTACGCCGACGACGCGCTCGAAGTTGGATTTCTCGTCGCCCAGGATGCTGG
JMFN031H17- CGCGCTCGAAGTTGGATTTCTCGTCGCCCAGGATGCTGG
                      ____________________________________________________________
consensus CGACGAGGTTTACGCCGACGACGCGCTCGAAGTTGGATTTCTCGTCGCCCAGGATGCTGG
 
. : . : . : . : . : . :
JMFN031F19- GTCGGTTCAGTCCCGTGATTCCGGCGTTGTTGTACATGATGTCGAGCTTGCCGAATTTTG
JMFF049J01+ GTCGGTTCAGTCCCGTGATTCCGGCGTTGTTGTACATGATGTCGAGCTTGCCGAATTTTG
JMFF027H15+ GTCGGTTCAGTCCCGTGATTCCGGCGTTGTTGTACATGATGTCGAGCTTGCCGAATTTTG
JMFN031H17- GTCGGTTCAGTCCCGTGATTCCGGCGTTGTTGTACATGATGTCGAGCTTGCCGAATTTTG
                      ____________________________________________________________
consensus GTCGGTTCAGTCCCGTGATTCCGGCGTTGTTGTACATGATGTCGAGCTTGCCGAATTTTG
 
. : . : . : . : . : . :
JMFN031F19- AAACGGCGGCGTTGACGGCGTTTTCAACGTCGGATTCCTTCG
JMFF049J01+ AAACGGCGGCGTTGACGGCGTTTTCAACGTCGGATTCCTTCGTCACGTCGCAGCGGACAA
JMFF027H15+ AAACGGCGGCGTTGACGGCGTTCTCAACGTCGGATTCCTTCGTCACGTCGCAGCGGACAA
JMFN031H17- AAACGGCGGCGTTGACGGCGTTTTCAACGTCGGATTCCTTCGTCACGTCGCAGCGGACAA
                      ____________________________________________________________
consensus AAACGGCGGCGTTGACGGCGTTTTCAACGTCGGATTCCTTCGTCACGTCGCAGCGGACAA
 
. : . : . : . : . : . :
JMFF049J01+ AGGTGGCCGACGACGCGGTGTCCAATTCGTCGCAAACTTTTTGCGCTAAATCATCTTGAA
JMFF027H15+ AGGTGGCCGACGACGCGGTGTCCAATTCGTCGCAAACTTTTTGCGCTAAATCATCTTGAA
JMFN031H17- AGGTGGCCGACGACGCGGTGTCCAATTCGTCGCAAACTTTTTGCGCTAAATCATCTTGAA
                      ____________________________________________________________
consensus AGGTGGCCGACGACGCGGTGTCCAATTCGTCGCAAACTTTTTGCGCTAAATCATCTTGAA
 
. : . : . : . : . : . :
JMFF049J01+ TGTCCGCTATCACCACCTTAGCTCCATGCCGGGAAAACAGCCTCGCTGCCTTCTCGCCGA
JMFF027H15+ TGTCCGCTATCACCACCTTAGCTCCATGCCGGGAAAACAGCCTCGCTGCCTTCTCGCCGA
JMFN031H17- TGTCCGCTATCACCACCTTAGCTCCATGCCGGGAAAACAGCCTCGCTGCCTTCTCGCCGA
                      ____________________________________________________________
consensus TGTCCGCTATCACCACCTTAGCTCCATGCCGGGAAAACAGCCTCGCTGCCTTCTCGCCGA
 
. : . : . : . : . : . :
JMFF049J01+ TGCCGCTGGCGGCGCCGGTGATGAGCGCAACCTTTCCTTCTAGCCT
JMFF027H15+ TGCCGCTGGCGGCGCCGGTGATGAGCGCAACCTTTCCTTCTAGCCT
JMFN031H17- TGCCGCTGGCGGCGCCGGTGATGAGCGCAACCTTTCCTTCTAGCCTAAATAGGAAATAAT
                      ____________________________________________________________
consensus TGCCGCTGGCGGCGCCGGTGATGAGCGCAACCTTTCCTTCTAGCCTAAATAGGAAATAAT
 
. : . : . : . : . : . :
JMFN031H17- GTATCGATATATATATATATATATATATATATATATATATATATATGAATTTCACAAATC
                      ____________________________________________________________
consensus GTATCGATATATATATATATATATATATATATATATATATATATATGAATTTCACAAATC
 
. : . : . : . : . : . :
JMFN031H17- AAATTTAGAACAATATTATTAAGGCTCAATCTCATCGTGACATCATGAGTTTATTCCACT
                      ____________________________________________________________
consensus AAATTTAGAACAATATTATTAAGGCTCAATCTCATCGTGACATCATGAGTTTATTCCACT
 
. : . : . : . : . : . :
JMFN031H17- TTTTATCCTATCATCCTGAGATTATTTTCACATTTGGTCTCACGATGTTAAAACTTTGTC
                      ____________________________________________________________
consensus TTTTATCCTATCATCCTGAGATTATTTTCACATTTGGTCTCACGATGTTAAAACTTTGTC