Previous Contig 002580:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022A09Sequence510002580 (17)gb:AB005232_15092998e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721355002580 (17)gb:AF521961_18079549e-15Helianthus annuus translation initiation factor B04 mRNA, complete cds.
JMFF026P06Sequence413002580 (17)gb:AB005232_15092997e-44Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721503002580 (17)gb:AB005232_15092992e-34Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFF034P18Sequence517002580 (17)gb:AB005232_15092998e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721503002580 (17)gb:AB005232_15092992e-44Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFF049L05Sequence648002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721636002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN006H23Sequence640002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN006K01Sequence626002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN012H11Sequence627002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN019G11Sequence176002580 (17)
JMFN028B22Sequence613002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN031A17Sequence561002580 (17)pir|S50119|S501199e-19activating factor (clone 12) - common tobacco>gb:TOBPASEQC_1725486 Nicotiana tab
JMFN033A23Sequence606002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN035A22Sequence602002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721
JMFN042N01Sequence594002580 (17)gb:AB005232_15092991e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBG8.>gb:AY087132_15721

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049L05- CCTTATGGCGGATCACCCTGGAGAGXXXX
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGNNNN
 
. : . : . : . : . : . :
rJMFF049L05- XXXXXXXXXXXXXXGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN035A22+ TGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
rJMFF026P06- TTATTGCTGGAAGAGAAAGTTGAATT
rJMFF022A09- TTGCTGGAAGAGAAAGTTGAATT
JMFN019G11- AAATATAAAACCCACATTTATTGCTGGAAAAAAAAGTTGAATT
JMFF049L05+ TGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN012H11+ TGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN042N01+ TGCTGGAAGAGAAAGTGAATTT
rJMFF034P18- ATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN006H23+ GATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN028B22+ AATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN033A23+ ATTTATTGCTGGAAGAGAAAGTTGAATT
JMFN006K01+ TGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
                      ____________________________________________________________
consensus NNNNNNNNNNNNNTGATAAATATAAAACCCACATTTATTGCTGGAAGAGAAAGTTGAATT
 
. : . : . : . : . : . :
rJMFF049L05- ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN035A22+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
rJMFF026P06- ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
rJMFF022A09- ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN019G11- ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFF049L05+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN012H11+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN042N01+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
rJMFF034P18- ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN006H23+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN028B22+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN033A23+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
JMFN006K01+ ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
                      ____________________________________________________________
consensus ACAATTCAACAGCCACCCCATGACATGACTATGGGCATGGAAATCAATTCAAAATGAAAA
 
. : . : . : . : . : . :
rJMFF049L05- ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN035A22+ ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
rJMFF026P06- ATTCAGG-AAAAAAAAAAAAGGCAAACAACNCCAGNACTGCAATATATTTGNATAATCTA
rJMFF022A09- ATTCAGG-AAAAAAAAAAAAGGCAAACAACNCCAGNACTGCAATATNTTTGNATAATCTA
JMFN019G11- ATTCAGGAAAAAAAAAAAAAGGCAAACAACCCCAGTACTGCAATATATTTGTATAATCTA
JMFF049L05+ ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN012H11+ ATTCAGG--AAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN042N01+ ATTCAGG---AAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
rJMFF034P18- ATTCAGG--AAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN006H23+ ATTCAGG--AAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN028B22+ ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN033A23+ ATTCAGG--AAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFN006K01+ ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
JMFF022A09+ CCAGTACTGCAATATATTTGTATAATCTA
JMFF034P18+ AAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
                      ____________________________________________________________
consensus ATTCAGG-AAAAAAAAAAAAGGCAAACAACACCAGTACTGCAATATATTTGTATAATCTA
 
. : . : . : . : . : . :
rJMFF049L05- TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN035A22+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
rJMFF026P06- TAGTCTTATGATTGCNCNCAAACAGNGGAGGTAAAAAAGGACTAAAAACCATGAATCTTA
rJMFF022A09- TAGNCTTATGATTGCNCNCANACNGGGGAGGTAAAAAAGGACTAAAANCCATGAATCTTA
JMFN019G11- TAGTCTTATGATT
JMFF049L05+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN012H11+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN042N01+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
rJMFF034P18- TAGTCTTATGATTGCNCACANACAGNGGAGGTAAANAAGGACTAAAAACCATGAATCTTA
JMFN006H23+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN028B22+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN033A23+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFN006K01+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFF022A09+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
JMFF034P18+ TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
                      ____________________________________________________________
consensus TAGTCTTATGATTGCACACAGACAGTGGAGGTAAAGAAGGACTAGAAACCATGAATCTTA
 
. : . : . : . : . : . :
rJMFF049L05- ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN035A22+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
rJMFF026P06- ATCTGATCCTTCTTCNCNANCCCANCANTGACAAGGAANTGGGACNCGTTCTTGCNCTGA
rJMFF022A09- ATCTGATCCTTCTTCNCNANCCCAGCANTGACAAGGAANTGGGACNCGTTCTTGCNCTGA
JMFF049L05+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN012H11+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN042N01+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
rJMFF034P18- ATCTGATCCTTCTTCACNAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCNCTGA
JMFN006H23+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN028B22+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN033A23+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFN006K01+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFF026P06+ CTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFF022A09+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
JMFF034P18+ ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
                      ____________________________________________________________
consensus ATCTGATCCTTCTTCACGAGCCCAGCACTGACAAGGAACTGGGACACGTTCTTGCGCTGA
 
. : . : . : . : . : . :
rJMFF049L05- TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN035A22+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
rJMFF026P06- TCNCCTTGNANCTGNATCNCCTTCCCCANCTCCTTGTCCTGCACAANNTTACCGTTGCAN
rJMFF022A09- TCNCCTNGGAGCTGNATCNCCTTCCCCAGCTCCTTGNCCNGCACAACATTACCGTTGCAN
JMFF049L05+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN012H11+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN042N01+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
rJMFF034P18- TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN006H23+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN028B22+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN033A23+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFN006K01+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFF026P06+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFF022A09+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
JMFF034P18+ TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
                      ____________________________________________________________
consensus TCGCCTTGGAGCTGTATCACCTTCCCCAGCTCCTTGTCCTGCACAACATTACCGTTGCAG
 
. : . : . : . : . : . :
rJMFF049L05- CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN035A22+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
rJMFF026P06- CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGNCGAAACTGNACTCCTTCCTCACCCCT
rJMFF022A09- CAAAACTCTTTCTTGAGGNCTTTGAGGATCTTG
JMFF049L05+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN012H11+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN042N01+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
rJMFF034P18- CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGNAACTGTACTCCTTCCTCAGCCCT
JMFN006H23+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN028B22+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN033A23+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN006K01+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFF026P06+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFF022A09+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFF034P18+ CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
JMFN031A17+ CTGTACTCCTTCCTCAGCCCT
                      ____________________________________________________________
consensus CAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGTCGTAACTGTACTCCTTCCTCAGCCCT
 
. : . : . : . : . : . :
rJMFF049L05- TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN035A22+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
rJMFF026P06- TGCACAGTTGTCAAACTCTTCTTTCCNTTCCTCTGCTGGATGCGGANATGCNCATACTCC
JMFF049L05+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN012H11+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN042N01+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
rJMFF034P18- TGCACAGTTGTCAAACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN006H23+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN028B22+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN033A23+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN006K01+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFF026P06+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFF022A09+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFF034P18+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
JMFN031A17+ TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
                      ____________________________________________________________
consensus TGCACAGTTGTCAGACTCTTCTTTCCATTCCTCTGCTGGATGCGGATATGCACATACTCC
 
. : . : . : . : . : . :
rJMFF049L05- TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN035A22+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
rJMFF026P06- TTCNCTCCAGGGGCNCCCNATTCCTTGGCCTCGGNAAACGGATCAAAAGCGGT
JMFF049L05+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN012H11+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN042N01+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
rJMFF034P18- TTCNCTCCAGGGGCGCCCNATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGG
JMFN006H23+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN028B22+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN033A23+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN006K01+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFF026P06+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFF022A09+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFF034P18+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
JMFN031A17+ TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
                      ____________________________________________________________
consensus TTCGCTCCAGGGGCGCCCGATTCCTTGGCCTCGGCAAACGGATCAAAAGCGGTTGGGAGA
 
. : . : . : . : . : . :
rJMFF049L05- TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAG-AAACTGTCGCTTCGATCTGAA
JMFN035A22+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFF049L05+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN012H11+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN042N01+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN006H23+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN028B22+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN033A23+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN006K01+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFF026P06+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFF022A09+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFF034P18+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
JMFN031A17+ TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
                      ____________________________________________________________
consensus TGAGCCTCGATATCAACCATGTAACTTGCTTGATGAAGAAAACTGTCGCTTCGATCTGAA
 
. : . : . : . : . : . :
rJMFF049L05- ACCTTTACC
JMFN035A22+ ACCTTTACCAGCGAG
JMFF049L05+ ACCTTTACCAGCGAGCT
JMFN012H11+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAG
JMFN042N01+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAA
JMFN006H23+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAG
JMFN028B22+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGG
JMFN033A23+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAGCT
JMFN006K01+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAGCT
JMFF026P06+ ACCTTTACCAGCGAGCT
JMFF022A09+ ACCTTTACCAGCGAGCT
JMFF034P18+ ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAGCTTCAATGA
JMFN031A17+ ACCTTTACCAGCGAGCTGCAGATCAAAAACCCCCATCAAAACCATAAATCCCGATCATAA
                      ____________________________________________________________
consensus ACCTTTACCAGCGAGCTTGAGAGCGTAGAAGGCAAAAGCTTCCATGAATCCCGATCATAA
 
. : . : . : . : . : . :
JMFN031A17+ TTCATAACAACAGATCATATTATATCACATCAAACAAAATCAACAACGAATAATCCATGA
                      ____________________________________________________________
consensus TTCATAACAACAGATCATATTATATCACATCAAACAAAATCAACAACGAATAATCCATGA
 
. : . : . : . : . : . :
JMFN031A17+ ATTCTTCCAAAGATCAAAACATTAGGGCTGATGAACCGCTCCTACTGTAATCCAATCTTC
                      ____________________________________________________________
consensus ATTCTTCCAAAGATCAAAACATTAGGGCTGATGAACCGCTCCTACTGTAATCCAATCTTC
 
. : . : . : . : . : . :
JMFN031A17+ AACAGAAGGATACATAGGAAACCCTAATGGCCACAAAATTAAATTCAACGCAAAATTTCA
                      ____________________________________________________________
consensus AACAGAAGGATACATAGGAAACCCTAATGGCCACAAAATTAAATTCAACGCAAAATTTCA
 
. : . : . : . : . : . :
JMFN031A17+ GAGAGAATCTAATAATCTATTGAGCTCGAGACATGGATCGCATCAAATCAAAATCTAACA
                      ____________________________________________________________
consensus GAGAGAATCTAATAATCTATTGAGCTCGAGACATGGATCGCATCAAATCAAAATCTAACA
 
. : . : . : . : . : . :
JMFN031A17+ AATAATAATCATAAACGAAAACTAAAAGAAGAAGAAAACGGAGAAAAGCTTATAATTACT
                      ____________________________________________________________
consensus AATAATAATCATAAACGAAAACTAAAAGAAGAAGAAAACGGAGAAAAGCTTATAATTACT