Previous Contig 002578:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007J13Sequence570002578 (2)gb:AF289060_17835231e-64Ipomoea batatas sporamin (spo-9) mRNA, complete cds.
JMFN030K08Sequence610002578 (2)gb:AF289060_17835231e-73Ipomoea batatas sporamin (spo-9) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN030K08+ GCCGACGTTG
                      ____________________________________________________________
consensus GCCGACGTTG
 
. : . : . : . : . : . :
JMFN030K08+ TAGCATTTGTCGGAGCCGAACTGACAGTAAGTGAGTTTGTAGAAGTTAAGGTTGGCATCC
                      ____________________________________________________________
consensus TAGCATTTGTCGGAGCCGAACTGACAGTAAGTGAGTTTGTAGAAGTTAAGGTTGGCATCC
 
. : . : . : . : . : . :
JMFN007J13+ ACCACCTCAATCTTGAACTGGTTGCTATTGTCGGAGACAAACTCGCCGGCTTTCAAGAAA
JMFN030K08+ ACCACCTCAATCTTGAACTGGTTGCTATTGTCGGAGACAAACTCGCCGGCTTTCAAGAAA
                      ____________________________________________________________
consensus ACCACCTCAATCTTGAACTGGTTGCTATTGTCGGAGACAAACTCGCCGGCTTTCAAGAAA
 
. : . : . : . : . : . :
JMFN007J13+ TACTGCCCGAACGCGCCGTCGTGCTGGATCCCCCAGTTCACGTTGTTTACGCAGAGCTTG
JMFN030K08+ TACTGCCCGGACGCGCCGTCGTGCTGGATCCCCCAGTTCACGTTGTTTACGCAGAGCTTG
                      ____________________________________________________________
consensus TACTGCCCGGACGCGCCGTCGTGCTGGATCCCCCAGTTCACGTTGTTTACGCAGAGCTTG
 
. : . : . : . : . : . :
JMFN007J13+ TTGGTGGCGACGTTGAACCGGAAGGTCTGGTACGTCGACGGCATGACGACGGTGGCTTCC
JMFN030K08+ TTGGTGGCGACGTTGAACCGGAAGGTCTGGTACGTCGACGGCATGACGACGGTGGCTTCC
                      ____________________________________________________________
consensus TTGGTGGCGACGTTGAACCGGAAGGTCTGGTACGTCGACGGCATGACGACGGTGGCTTCC
 
. : . : . : . : . : . :
JMFN007J13+ GCCGCCGCCGGCGTGATGGTGATGGGGTCGCCGTTGTCTAAGTCGCTCGGGGATACGATC
JMFN030K08+ GCCGCCGCCGGCGTGATGGTGATGGGGTCGCCGTTGTCTAAGTCGCTCGGGGATACGATC
                      ____________________________________________________________
consensus GCCGCCGCCGGCGTGATGGTGATGGGGTCGCCGTTGTCTAAGTCGCTCGGGGATACGATC
 
. : . : . : . : . : . :
JMFN007J13+ ACGTCGCTGGCGCATTTGCTCATCATGTCCAGCCGGGCGAGTCTCAGCCCTCCTCCGCCG
JMFN030K08+ ACGTCGCTGGCGCATTTGCTCATCATGTCCAGCCGGGCGAGTCTCAGCCCTCCTCCGCCG
                      ____________________________________________________________
consensus ACGTCGCTGGCGCATTTGCTCATCATGTCCAGCCGGGCGAGTCTCAGCCCTCCTCCGCCG
 
. : . : . : . : . : . :
JMFN007J13+ GCTCCCCATACGGCGGAGACCATGTAGTAGTTCCCGCCGGCGACGACCGCGTCGCCGTTG
JMFN030K08+ GCTCCCCATACGGCGGAGACCATGTAGTAGTTCCCGCCGGCGACGACCGCGTCGCCGTTG
                      ____________________________________________________________
consensus GCTCCCCATACGGCGGAGACCATGTAGTAGTTCCCGCCGGCGACGACCGCGTCGCCGTTG
 
. : . : . : . : . : . :
JMFN007J13+ GCGTCTAGCACCGGAGTTTCAGACGAGGCGGCGGCTTCGTGTGTGGTGGGGAGGCGGATG
JMFN030K08+ GCGTCTAGCACCGGAGTTTCAGACGAGGCGGCGGCTTCGTGTGTGGTGGGGAGGCGGATG
                      ____________________________________________________________
consensus GCGTCTAGCACCGGAGTTTCAGACGAGGCGGCGGCTTCGTGTGTGGTGGGGAGGCGGATG
 
. : . : . : . : . : . :
JMFN007J13+ GGATTGAAGGTGGAATGAGCTGGGTTGGGGAGGAGATAGAGGGAAAGAGCGAAGAAGAGT
JMFN030K08+ GGATTGAAGGTGGAATGAGCTGGGTTGGGGAGGAGATAGAGGGAAAGAGCGAAGAAGAGT
                      ____________________________________________________________
consensus GGATTGAAGGTGGAATGAGCTGGGTTGGGGAGGAGATAGAGGGAAAGAGCGAAGAAGAGT
 
. : . : . : . : . : . :
JMFN007J13+ AAGAGGGCTTTCAT
JMFN030K08+ AAGAGGGCTTTCATCATGACTTAATTGGGAGAAAGCTAAGAGGTAATGATGTTTAATTTA
                      ____________________________________________________________
consensus AAGAGGGCTTTCATCATGACTTAATTGGGAGAAAGCTAAGAGGTAATGATGTTTAATTTA