Previous Contig 002562:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN029A01Sequence578002562 (2)
JMFN031J13Sequence578002562 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031J13+ TAATACGCACTGCCATTCCATTAGTCCAACATAATAC
JMFN029A01+ NTAATACGCACTGCCATTCCATTAGTCCAACATAATAC
                      ____________________________________________________________
consensus NTAATACGCACTGCCATTCCATTAGTCCAACATAATAC
 
. : . : . : . : . : . :
JMFN031J13+ ATCAACAGAAAGTCAGAAATAATCCAAACGTCCAAATGTCCAATACAAGTCTTAACAAAT
JMFN029A01+ ATCAACAGAAAGTCAGAAATAATCCAAACGTCCAAATGTCCAATACAAGTCTTAACAAAT
                      ____________________________________________________________
consensus ATCAACAGAAAGTCAGAAATAATCCAAACGTCCAAATGTCCAATACAAGTCTTAACAAAT
 
. : . : . : . : . : . :
JMFN031J13+ TAACAAGTGATAAAAAATTAAGAACAAACAATTAAAAACATTGATAATTCATAGATTTCA
JMFN029A01+ TAACAAGTGATAAAAAATTAAGAACAAACAATTAAAAACATTGATAATTCATAGATTTCA
                      ____________________________________________________________
consensus TAACAAGTGATAAAAAATTAAGAACAAACAATTAAAAACATTGATAATTCATAGATTTCA
 
. : . : . : . : . : . :
JMFN031J13+ TGAAACAACATCCTGCCAAGCTTCAAATCCTTCAAATCTTCAAATCTTCAATTTCTTCAA
JMFN029A01+ TGAAACAACATCCTGCCAAGCTTCAAATCCTTCAAATCTTCAAATCTTCAATTTCTTCAA
                      ____________________________________________________________
consensus TGAAACAACATCCTGCCAAGCTTCAAATCCTTCAAATCTTCAAATCTTCAATTTCTTCAA
 
. : . : . : . : . : . :
JMFN031J13+ ATCTAGATGGCTGGCTGAGTAGCAGAGTAGTTGACTGGAGCTTGGAGTAGAGACGTTGCC
JMFN029A01+ ATCTAGATGGCTGGCTGAGTAGCAGAGTAGTTGACTGGAGCTTGGAGTAGAGACGTTGCC
                      ____________________________________________________________
consensus ATCTAGATGGCTGGCTGAGTAGCAGAGTAGTTGACTGGAGCTTGGAGTAGAGACGTTGCC
 
. : . : . : . : . : . :
JMFN031J13+ GGCGAGGAAAGGTGGTGTCGCCGTGCCAGACTGTCGGAGGACGGAGAGGCCGGGAGGCGA
JMFN029A01+ GGCGAGGAAAGGTGGTGTCGCCGTGCCAGACTGTCGGAGGACGGAGAGGCCGGGAGGCGA
                      ____________________________________________________________
consensus GGCGAGGAAAGGTGGTGTCGCCGTGCCAGACTGTCGGAGGACGGAGAGGCCGGGAGGCGA
 
. : . : . : . : . : . :
JMFN031J13+ GAGCTGATTAGTTGGGAGTTTGAGAGGGCGTGAGGGCGGTGAGGCTGAGGTGTAGCCGAT
JMFN029A01+ GAGCTGATTAGTTGGGAGTTTGAGAGGGCGTGAGGGCGGTGAGGCTGAGGTGTAGCCGAT
                      ____________________________________________________________
consensus GAGCTGATTAGTTGGGAGTTTGAGAGGGCGTGAGGGCGGTGAGGCTGAGGTGTAGCCGAT
 
. : . : . : . : . : . :
JMFN031J13+ TCCGGTCTTTCAGTGGAACTAGAAGGTGGAAGTTCCACCGTGAAACAGTGGAAGGCTTCA
JMFN029A01+ TCCGGTCTTTCAGTGGAACTAGAAGGTGGAAGTTCCACCGTGAAACAGTGGAAGGCTTCA
                      ____________________________________________________________
consensus TCCGGTCTTTCAGTGGAACTAGAAGGTGGAAGTTCCACCGTGAAACAGTGGAAGGCTTCA
 
. : . : . : . : . : . :
JMFN031J13+ GCTGATTCTGGTCTTCAGTCTTCTGGAGAGTGGAGAAGACGAGAATGCGAATCGCGAATC
JMFN029A01+ GCTGATTCTGGTCTTCAGTCTTCTGGAGAGTGGAGAAGACGAGAATGCGAATCGCGAATC
                      ____________________________________________________________
consensus GCTGATTCTGGTCTTCAGTCTTCTGGAGAGTGGAGAAGACGAGAATGCGAATCGCGAATC
 
. : . : . : . : . : . :
JMFN031J13+ GCGAAACGGCGAAAGGTTGAAGGAGTGAAGGGCTGAGGGCGTGAAGTGATTTTAGTGATT
JMFN029A01+ GCGAAACGGCGAAAGGTTGAAGGAGTGAAGGGCTGAGGGCGTGAAGTGATTTTAGTGATT
                      ____________________________________________________________
consensus GCGAAACGGCGAAAGGTTGAAGGAGTGAAGGGCTGAGGGCGTGAAGTGATTTTAGTGATT