Previous Contig 002560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028P03Sequence618002560 (13)pir|T47769|T477693e-58hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMFN030B04Sequence641002560 (13)pir|T47769|T477699e-53hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMFN030I20Sequence569002560 (13)pir|T47769|T477697e-53hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMFN036N05Sequence625002560 (13)pir|T47769|T477698e-59hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMFN040O20Sequence633002560 (13)pir|T47769|T477699e-53hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMSF030M24Sequence656019640pir|T47769|T477692e-06hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido596002560 (13)pir|T47769|T477698e-26hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMSF040A10Sequence681020042pir|T47769|T477693e-06hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido808002560 (13)pir|T47769|T477691e-37hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMSF040P10Sequence685002560 (13)pir|T47769|T477691e-52hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido699002560 (13)pir|T47769|T477691e-52hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido
JMSF041J13Sequence802002560 (13)pir|T47769|T477699e-52hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido590002560 (13)gb:AP003735_18326451e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF041K13Sequence858002560 (13)pir|T47769|T477692e-52hypothetical protein F24I3.170 - Arabidopsis thaliana>gb:ATF24I3_1549908 Arabido725002560 (13)gb:AP003735_18326455e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041K13+ TTTTTTTTTTAGCCTGAAAAAGAAGATGGAATTATATCACAAAATTC
                      ____________________________________________________________
consensus TTTTTTTTTTAGCCTGAAAAAGAAGATGGAATTATATCACAAAATTC
 
. : . : . : . : . : . :
rJMSF041K13- GAAGATAGATTTGACT-GTTACAGATG-ATGTTGCACTAGCCAAATTA
rJMSF030M24- GAAGATAGATTTGACT-GTTACAGATG-ATGTTGCACTAGCCAAATTA
rJMSF041J13- AAGATAGATTTGACTGGTTACAGATGAATGTTGCACTAGCCAAATTA
JMSF041K13+ AGAGACACAGGAGAAGATAGATTTGACT-GTTACAGATG-ATGTTGCACTAGCCAAATTA
JMSF041J13+ GAAGATAGATTTGACT-GTTACAGATG-ATGTTGCACTAGCCAAATTA
                      ____________________________________________________________
consensus AGAGACACAGGAGAAGATAGATTTGACT-GTTACAGATG-ATGTTGCACTAGCCAAATTA
 
. : . : . : . : . : . :
rJMSF041K13- TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
rJMSF040A10- AGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
rJMSF030M24- TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
rJMSF041J13- TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
JMSF041K13+ TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
JMSF041J13+ TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
                      ____________________________________________________________
consensus TTAAACATAAGTAATTATGCATCAAAATGGCCATGAAACAACAGTTAACTATATTGAAAG
 
. : . : . : . : . : . :
rJMSF041K13- TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
rJMSF040A10- TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
rJMSF030M24- TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
rJMSF041J13- TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
JMSF041K13+ TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
JMSF041J13+ TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
rJMSF040P10- GGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
JMSF040P10+ TGGACGGACGAAAAGCTTTAAAACAGGGT
                      ____________________________________________________________
consensus TTGGGTTCTATATTTCAGGGTCCTACCAGGGTGGACGGACGAAAAGCTTTAAAACAGGGT
 
. : . : . : . : . : . :
rJMSF041K13- GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
rJMSF040A10- GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
rJMSF030M24- GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
rJMSF041J13- GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
JMSF041K13+ GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
JMSF041J13+ GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
rJMSF040P10- GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
JMSF040P10+ GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
JMFN040O20+ GAATA
JMFN030B04+ ATTGAACAGAATA
                      ____________________________________________________________
consensus GGTCTCTCAAGGTAGACTGTAGACTCATGGGACCTGAACATGGACCAATTGAACAGAATA
 
. : . : . : . : . : . :
rJMSF041K13- GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
rJMSF040A10- GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
rJMSF030M24- GCAGATGGTGTTTGTTATGCACATTAGTTGTTCACATGATTGGGTGGTCATTTCTTGCGG
rJMSF041J13- GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
JMSF041K13+ GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
JMSF041J13+ GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
rJMSF040P10- GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
JMSF040P10+ GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
JMFN040O20+ GCAGATGGTGTTGTTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
JMFN030I20+ GCGG
JMFN030B04+ GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
                      ____________________________________________________________
consensus GCAGATGGTGTTTGTTATGCACATTAGTTGTTTACATGATTGGGTGGTCATTTCTTGCGG
 
. : . : . : . : . : . :
rJMSF041K13- GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
rJMSF040A10- GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
rJMSF030M24- GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
rJMSF041J13- GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMSF041K13+ GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMSF041J13+ GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
rJMSF040P10- GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMSF040P10+ GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMFN040O20+ GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMFN030I20+ GACAGTGCGGCAGCAATCCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMFN030B04+ GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMFN036N05+ GCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
JMFN028P03+ AGCAGTAGCAGCAATGCCAATG
                      ____________________________________________________________
consensus GACAGTGCGGCAGCAATTCCACCGGCCAAAAGGCCAACAGCAGTAGCAGCAATGCCAATG
 
. : . : . : . : . : . :
rJMSF041K13- CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
rJMSF040A10- CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
rJMSF030M24- CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
rJMSF041J13- CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMSF041K13+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMSF041J13+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
rJMSF040P10- CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMSF040P10+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMFN040O20+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMFN030I20+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMFN030B04+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMFN036N05+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
JMFN028P03+ CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
                      ____________________________________________________________
consensus CCAATCACTCCATCTTTAGTGATCTTATCTTCAATTGCCTTCTTCAAGGTCAATGCCTGC
 
. : . : . : . : . : . :
rJMSF041K13- CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
rJMSF040A10- CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
rJMSF030M24- CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
rJMSF041J13- CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMSF041K13+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMSF041J13+ CTCCAATNTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
rJMSF040P10- CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMSF040P10+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMFN040O20+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMFN030I20+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMFN030B04+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMFN036N05+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
JMFN028P03+ CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
                      ____________________________________________________________
consensus CTCCAATCTGGTGCAATCTCCAAACAACGCTCCGCAATCTGCCTGCTTCTAGGATAGTCC
 
. : . : . : . : . : . :
rJMSF041K13- CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
rJMSF040A10- CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
rJMSF030M24- CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
rJMSF041J13- CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMSF041K13+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMSF041J13+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
rJMSF040P10- CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMSF040P10+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMFN040O20+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMFN030I20+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMFN030B04+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMFN036N05+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
JMFN028P03+ CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
                      ____________________________________________________________
consensus CCACTTCTGTAGTAACCAACACCCAGAAGATAAAGCCTTTCCCTCTGTTGCAGTGGACTA
 
. : . : . : . : . : . :
rJMSF041K13- CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
rJMSF040A10- CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
rJMSF030M24- CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
rJMSF041J13- CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATACCCACGCTGGACGTCTTCTGGACG
JMSF041K13+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMSF041J13+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
rJMSF040P10- CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMSF040P10+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMFN040O20+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMFN030I20+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMFN030B04+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMFN036N05+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
JMFN028P03+ CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
                      ____________________________________________________________
consensus CTGATGACACCCAGAGAAGCTTCAAGCATTGCGATA-CCACGCTGGACGTCTTCTGGACG
 
. : . : . : . : . : . :
rJMSF041K13- CTTTGAATGAACAAGAGCCCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
rJMSF040A10- CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
rJMSF030M24- CTTTGAATGAA
rJMSF041J13- CTT
JMSF041K13+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMSF041J13+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
rJMSF040P10- CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMSF040P10+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMFN040O20+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMFN030I20+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMFN030B04+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMFN036N05+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
JMFN028P03+ CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
                      ____________________________________________________________
consensus CTTTGAATGAACAAGAG-CCCAAGACAAGCGCATTATGCATTCACTTTTAATTGCTTCAG
 
. : . : . : . : . : . :
rJMSF041K13- AAGCACCTTTTNCAGCATCTGCAACCTCACGCTCACAGNCCAACGACGATATCNGGCATC
rJMSF040A10- AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CC
JMSF041K13+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMSF041J13+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
rJMSF040P10- AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMSF040P10+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMFN040O20+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMFN030I20+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMFN030B04+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMFN036N05+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
JMFN028P03+ AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
                      ____________________________________________________________
consensus AAGCACCTTTTTCAGCATCTGCAACCTCACGCTCACAG-CCAACGACGATATC-GGCATC
 
. : . : . : . : . : . :
rJMSF041K13- GCACCAAGGAATCTGGTCG
JMSF041K13+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMSF041J13+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
rJMSF040P10- GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMSF040P10+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMFN040O20+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMFN030I20+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMFN030B04+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMFN036N05+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
JMFN028P03+ GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
                      ____________________________________________________________
consensus GCACCAAGGAATCTGGTCGCCGCCGGAGAAGAAGTTGCCGACCGAATCGAAGAACTTGCT
 
. : . : . : . : . : . :
JMSF041K13+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGAC
JMSF041J13+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGAC
rJMSF040P10- CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCT
JMSF040P10+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCT
JMFN040O20+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
JMFN030I20+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
JMFN030B04+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
JMFN036N05+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
JMFN028P03+ CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
                      ____________________________________________________________
consensus CATCTTTGCTTCCATTTGCTTGCGTAGAGAGACGACGGTGACGGATATTTGATGGAGCTA
 
. : . : . : . : . : . :
JMFN040O20+ AGGAAATAGCAGAAGAGTAATGGCTAAGTTAA
JMFN030I20+ AGGAAATAGCAGAAGAGTAATGGCTAAGT
JMFN030B04+ AGGAAATAGCAGAAGAGTAATGGCTAAGTTAA
JMFN036N05+ AGGAAATAGCAGAGGAGTAATGGCTAAGTTAATACAACCGTTTGGTGAGTTGCTGAAGAA
JMFN028P03+ AGGAAATAGCAGAAGAGTAATGGCTAAGTTAATACAACCGTTTGGTGAGTTGCTGAAGAA
                      ____________________________________________________________
consensus AGGAAATAGCAGAAGAGTAATGGCTAAGTTAATACAACCGTTTGGTGAGTTGCTGAAGAA
 
. : . : . : . : . : . :
JMFN036N05+ AGTAGACTGGTTTTTCTTAACGGGGTGCGGGCGGGTCACGCGGCTAAACAACA
JMFN028P03+ AGTAGACTGGTTTTTCTTAACGGGGTGCGGGCGGGTCACGCGGCTAAACAACAGACCGAG
                      ____________________________________________________________
consensus AGTAGACTGGTTTTTCTTAACGGGGTGCGGGCGGGTCACGCGGCTAAACAACAGACCGAG