Previous Contig 002557:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010B16Sequence588000538 (5)gb:AY039977_15604815e-15Arabidopsis thaliana unknown protein (At4g28570) mRNA, complete cds.723002557 (6)gb:AE016959_10230693e-43Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMFF029G05Sequence583000538 (5)gb:AY039977_15604815e-15Arabidopsis thaliana unknown protein (At4g28570) mRNA, complete cds.724002557 (6)pir|T05821|T058211e-61hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi
JMFF034K18Sequence543000538 (5)gb:AY039977_15604816e-17Arabidopsis thaliana unknown protein (At4g28570) mRNA, complete cds.724002557 (6)pir|T05821|T058212e-62hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi
JMFN028L15Sequence482002557 (6)pir|T05821|T058212e-33hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi
JMSF048A14Sequence696000538 (5)pir|T05821|T058212e-21hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi695002557 (6)pir|T05821|T058212e-61hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi
JMSF050H17Sequence641000538 (5)pir|T05821|T058215e-61hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi710002557 (6)pir|T05821|T058214e-68hypothetical protein T5K18.160 - Arabidopsis thaliana>gb:ATCHRIV50_1545778 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF050H17+ CTACGA
                      ____________________________________________________________
consensus CTACGA
 
. : . : . : . : . : . :
rJMSF050H17+ AGGGGCGATAATGTCGGCGATGTCTACCGTCGTCTTAAACGTTAACGGAA-CAGGGTACG
rJMFF029G05+ TAAACGTTAACGGAA-CAGGGTACG
rJMFF010B16+ TAAACGTTAACGGAACCAGGGTACG
rJMSF048A14+ CGTTAACGGAA-CAGGGTACG
rJMFF034K18+ TAAACGTTAACGGAA-CAGGGTACG
                      ____________________________________________________________
consensus AGGGGCGATAATGTCGGCGATGTCTACCGTCGTCTTAAACGTTAACGGAA-CAGGGTACG
 
. : . : . : . : . : . :
rJMSF050H17+ GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCCTAATGCCATGGA
rJMFF029G05+ GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCCTAATGCCATGGA
rJMFF010B16+ GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCNTAATGCCATGGA
rJMSF048A14+ GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCCTAATGCCATGGA
rJMFF034K18+ GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCCTAATGCCATGGA
                      ____________________________________________________________
consensus GCGCGGTGATACAGACGCCGGCGTTACACCCGGGTTTGTTCTCCGCCCTAATGCCATGGA
 
. : . : . : . : . : . :
rJMSF050H17+ ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
rJMFF029G05+ ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
rJMFF010B16+ ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
rJMSF048A14+ ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
rJMFF034K18+ ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
                      ____________________________________________________________
consensus ATTCCGGGCAAGAATTCAAGATGAGGATGAGTAGATACGCAAGAACCGCCCACATCTTCG
 
. : . : . : . : . : . :
rJMSF050H17+ CGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAG-TAACCTACGAC
rJMFF029G05+ CGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAG-TAACCCTCGAC
rJMFF010B16+ CGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAGTTAACCCTCGAC
rJMSF048A14+ NGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAG-TAACCTACGAC
rJMFF034K18+ CGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAG-TAACCTACGAC
                      ____________________________________________________________
consensus CGCTGGCGAGGGATAAGGGCTCAGGGGAGGCGTTCTCGCCGACCTCAG-TAACCTACGAC
 
. : . : . : . : . : . :
rJMSF050H17+ CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
rJMFF029G05+ CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
rJMFF010B16+ CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
rJMSF048A14+ CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
rJMFF034K18+ CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
JMFN028L15- TG
                      ____________________________________________________________
consensus CTTGACAAAACCGACGAGGAGAATCTCCAGAGAGGGCTCGAGAAGCTGTTGAGGATACTG
 
. : . : . : . : . : . :
rJMSF050H17+ GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
rJMFF029G05+ GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
rJMFF010B16+ GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
rJMSF048A14+ GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
rJMFF034K18+ GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
JMFN028L15- GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
                      ____________________________________________________________
consensus GCGGCCGCCGGGGCCGAGGAGATTGGATGCAATCACGGCACAGGACTAACCCTCAAGGTG
 
. : . : . : . : . : . :
rJMSF050H17+ AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
rJMFF029G05+ AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
rJMFF010B16+ AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
rJMSF048A14+ AAGGATGCGAGCAGGGANGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
rJMFF034K18+ AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
JMFN028L15- AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
                      ____________________________________________________________
consensus AAGGATGCGAGCAGGGAAGAGTTTGAGAGGTTTGTGAAGGAAGAGAGTTCACAGAGTCTA
 
. : . : . : . : . : . :
rJMSF050H17+ AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
rJMFF029G05+ AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
rJMFF010B16+ AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
rJMSF048A14+ AGAAAACACCCGNATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
rJMFF034K18+ AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
JMFN028L15- AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
                      ____________________________________________________________
consensus AGAAAACACCCGAATCTGAAAGCTTCGGCGCACCAGATGGGGAGCTGCAGAATGGGAGTT
 
. : . : . : . : . : . :
rJMSF050H17+ GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
rJMFF029G05+ GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
rJMFF010B16+ GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
rJMSF048A14+ GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
rJMFF034K18+ GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
JMFN028L15- GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
                      ____________________________________________________________
consensus GATCCTAAGGCTTCAGTGGTGAACCCAAAGGGAGAGACATGGGAGGTGGAAGGGCTGTTT
 
. : . : . : . : . : . :
rJMSF050H17+ GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
rJMFF029G05+ GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
rJMFF010B16+ GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
rJMSF048A14+ GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATN
rJMFF034K18+ GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
JMFN028L15- GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
                      ____________________________________________________________
consensus GTTGGAGATGGGAGTGTTCTTCCTACGGCTTTAGGGGTGAACCCAATGGTCACCATTATG
 
. : . : . : . : . : . :
rJMSF050H17+ TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
rJMFF029G05+ TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
rJMFF010B16+ TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
rJMSF048A14+ TCTGTTTCTTATTGCATTTCCCAGTCTNTACTTGAGTTTCTTAAGACTCATGATTAAACT
rJMFF034K18+ TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
JMFN028L15- TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
                      ____________________________________________________________
consensus TCTGTTTCTTATTGCATTTCCCAGTCTGTACTTGAGTTTCTTAAGACTCATGATTAAACT
 
. : . : . : . : . : . :
rJMSF050H17+ AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATC
rJMFF029G05+ AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATCTGTGTGGATTGCTA
rJMFF010B16+ AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATCTGTGTGGATTGCTA
rJMSF048A14+ AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTNAATTTCGATCTGTGTGGATTGCTA
rJMFF034K18+ AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATCTGTGTGGATTGCTA
JMFN028L15- AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATCTGTGTGGATTGCTA
                      ____________________________________________________________
consensus AGCTAGCTTAATCATGCAATGGCTCATTGTCTTCTGAATTTCGATCTGTGTGGATTGCTA
 
. : . : . : . : . : . :
rJMFF029G05+ GCTGCAATAAAATATTTGTAATTTGTATT
rJMFF010B16+ GCTGCAATAAAATATTTGTAATTTGTATT
rJMSF048A14+ GCTGCAATAANATATT
rJMFF034K18+ GCTGCAATAAAATATTTGTAATTTGTATT
JMFN028L15- GCTGCAATAAAATATTTGTAATTTGTATTXXXXXXXXXXXXXXXXXXCTCGAACTAGTTC
                      ____________________________________________________________
consensus GCTGCAATAAAATATTTGTAATTTGTATTNNNNNNNNNNNNNNNNNNCTCGAACTAGTTC