Previous Contig 002556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019A15Sequence583002556 (10)gb:CAR275310_16451959e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.549002556 (10)gb:CAR275310_16451958e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFF042I14Sequence582002556 (10)gb:CAR275310_16451959e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.582002556 (10)gb:CAR275310_16451959e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFF047C24Sequence440002556 (10)gb:CAR275310_16451952e-22Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.375021782
JMFN014O09Sequence544002556 (10)gb:CAR275310_16451958e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFN016N01Sequence536002556 (10)gb:CAR275310_16451957e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFN017B07Sequence550002556 (10)gb:CAR275310_16451958e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFN020C03Sequence434002556 (10)gb:CAR275310_16451955e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.
JMFN028K24Sequence533002556 (10)gb:CAR275310_16451957e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can74-2.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042I14- GTAATGAAACCTT
JMFN017B07+ GTAATGAAACCTT
JMFF042I14+ GCAGTAATGAAACCTT
                      ____________________________________________________________
consensus GCAGTAATGAAACCTT
 
. : . : . : . : . : . :
JMFN014O09+ CACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
rJMFF042I14- GAAGTCACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
JMFN017B07+ GAAGTCACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
JMFN016N01+ CACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
JMFF042I14+ GAAGTCACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
rJMFF019A15- ATTTGAGCACCATCTCTAAATGATGACAGGA
JMFF019A15+ CAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
                      ____________________________________________________________
consensus GAAGTCACAGGTAAAAACCATTATTAACAATTTGAGCACCATCTCTAAATGATGACAGGA
 
. : . : . : . : . : . :
JMFN014O09+ ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
rJMFF042I14- ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
JMFN017B07+ ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
JMFN016N01+ ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
JMFF042I14+ ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
rJMFF019A15- ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
JMFF019A15+ ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
JMFN028K24+ GCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
                      ____________________________________________________________
consensus ACAAAGTGCACAATCAATCAATCATCACTGTCAGCGTGAATTTAACGAAAACATTCAACT
 
. : . : . : . : . : . :
JMFN014O09+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
rJMFF042I14- TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFN017B07+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFN016N01+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFF042I14+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
rJMFF019A15- TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFN020C03+ CTAAGCAGCAAAAGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFF019A15+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
JMFN028K24+ TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
                      ____________________________________________________________
consensus TCTAAGCAGCAAAGGGATTTCATTTCATCATTAAAACAAGGTAAATTACTCTAATAATAA
 
. : . : . : . : . : . :
JMFN014O09+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
rJMFF042I14- TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFN017B07+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFN016N01+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFF042I14+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
rJMFF019A15- TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFN020C03+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFF019A15+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
JMFN028K24+ TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
                      ____________________________________________________________
consensus TGGCTTTTGGTACACAATCAACTTTCAAGCCTTCACGCAGCAGTTGAAACATCTGAAGAT
 
. : . : . : . : . : . :
JMFN014O09+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
rJMFF042I14- GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFN017B07+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFN016N01+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFF042I14+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFF047C24+ GGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
rJMFF019A15- GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFN020C03+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFF019A15+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
JMFN028K24+ GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
                      ____________________________________________________________
consensus GCTCCTCCTCGTAGTTGGAGACTGGTTTTGATTGTAATGGTGGTCGTCGCTGTGAGCCGA
 
. : . : . : . : . : . :
JMFN014O09+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
rJMFF042I14- GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFN017B07+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFN016N01+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFF042I14+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFF047C24+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGATCTTCCTCATTCCCGAGACT
rJMFF019A15- GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFN020C03+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFF019A15+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
JMFN028K24+ GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
                      ____________________________________________________________
consensus GTGGCCTGCATTTGCACTGCCAGCGGTGGAAGACATAAGCTCTTCCTCATTCCCGAGACT
 
. : . : . : . : . : . :
JMFN014O09+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
rJMFF042I14- CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFN017B07+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFN016N01+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFF042I14+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFF047C24+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
rJMFF019A15- CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFN020C03+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFF019A15+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
JMFN028K24+ CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
                      ____________________________________________________________
consensus CGCCCTCGACAAGTCCCTCTTGTTCTGTTTCCTCATCTCTCTGATTTTGGAGAAGTCCAA
 
. : . : . : . : . : . :
JMFN014O09+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
rJMFF042I14- TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFN017B07+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFN016N01+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFF042I14+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFF047C24+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
rJMFF019A15- TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFN020C03+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFF019A15+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
JMFN028K24+ TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
                      ____________________________________________________________
consensus TGAATAATCTGGCAATGCTCCCTTTTGGTCCCAGTCCCCAAACTGTGGCACAGATAGCCA
 
. : . : . : . : . : . :
JMFN014O09+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
rJMFF042I14- TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFN017B07+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAG
JMFN016N01+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFF042I14+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFF047C24+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
rJMFF019A15- TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFN020C03+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFF019A15+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
JMFN028K24+ TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
                      ____________________________________________________________
consensus TGATGCATTCTTCTCCTTTTGGCCCTCCATCTGTGTGGTTTTCTATATGGGTACAAGAAA
 
. : . : . : . : . : . :
JMFN014O09+ AACAAACAA
rJMFF042I14- AACAAACAAGTCGGACAATATCAATC
JMFN016N01+ A
JMFF042I14+ AACAAACAAGTCGGACAATATCAATC
JMFF047C24+ AACAAACAAGTCGGACAATATCAATCAAGAAATC
rJMFF019A15- AACAAACAAGTCGGACAATATCAATCAAGAAATC
JMFN020C03+ AACAAACAAGTCGGA
JMFF019A15+ AACAAACAAGTCGGACAATATCAATCAAGAAATC
JMFN028K24+ AACAAACAAGTCGGACAATATCAATCAAGAAATCGGATAGATGAGAAAGATGTGTGTGCA
                      ____________________________________________________________
consensus AACAAACAAGTCGGACAATATCAATCAAGAAATCGGATAGATGAGAAAGATGTGTGTGCA