Previous Contig 002555:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028I06Sequence659002555 (2)gb:AY084817_15699005e-27Arabidopsis thaliana clone 11863 mRNA, complete sequence.
JMFS052A11Sequence474002555 (2)gb:ATAC023912_15437713e-15Arabidopsis thaliana chromosome III BAC F3E22 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028I06- TTTCATTTTCCATTCTCTTCTGCAATGTCGTCTAACAACAAATCTCCCATTTTTCCCTT
                      ____________________________________________________________
consensus TTTCATTTTCCATTCTCTTCTGCAATGTCGTCTAACAACAAATCTCCCATTTTTCCCTT
 
. : . : . : . : . : . :
JMFS052A11+ AGAA
JMFN028I06- CCCACAACCTCAACACTTCACTGACTATGTATTTGACCCTCAAGTCGACTACTTTCAGAA
                      ____________________________________________________________
consensus CCCACAACCTCAACACTTCACTGACTATGTATTTGACCCTCAAGTCGACTACTTTCAGAA
 
. : . : . : . : . : . :
JMFS052A11+ AAATATTTTGGAAGAAACGAGGAAGCACAAGAGCTTGTCAAGATCCTTAGACGCGTTCCG
JMFN028I06- AAATATTTTGGAAGAAACGAGGAAGCACAAGAGCTTGTCAAGATCCTTAGACGCGTTCCG
                      ____________________________________________________________
consensus AAATATTTTGGAAGAAACGAGGAAGCACAAGAGCTTGTCAAGATCCTTAGACGCGTTCCG
 
. : . : . : . : . : . :
JMFS052A11+ TTTCAAGCCTCAAAAGCCCATTTCCAAGGAGGACATCTCCCGGAAATTCAAGAAGAGCGG
JMFN028I06- TTTCAAGCCTCAAAAGCCCATTTCCAAGGAGGACATCTCCCGGAAATTCAAGAAGAGCGG
                      ____________________________________________________________
consensus TTTCAAGCCTCAAAAGCCCATTTCCAAGGAGGACATCTCCCGGAAATTCAAGAAGAGCGG
 
. : . : . : . : . : . :
JMFS052A11+ CGGCCGGAAACGGTGGTGGAAGAGCGCTCTGCTATTCTTCAAGTGGAATACGACCGCCGG
JMFN028I06- CGGCCGGAAACGGTGGTGGAAGAGCGCTCTGCTATTCTTCAAGTGGAATACGACCGCCGG
                      ____________________________________________________________
consensus CGGCCGGAAACGGTGGTGGAAGAGCGCTCTGCTATTCTTCAAGTGGAATACGACCGCCGG
 
. : . : . : . : . : . :
JMFS052A11+ CGCCCCCCCAGTCGCCAAAACCGAGGGTGATTCCACCGAGCGTGGGGCCAACCGTAACCG
JMFN028I06- CGCCCCCCCAGTCGCCAAAACCGAGGGTGATTCCACCGAGCGTGGGGCCAACCGTAACCG
                      ____________________________________________________________
consensus CGCCCCCCCAGTCGCCAAAACCGAGGGTGATTCCACCGAGCGTGGGGCCAACCGTAACCG
 
. : . : . : . : . : . :
JMFS052A11+ TGCCCGCGTGAGATCCGTGTATGGGCCGGTGTACTACATCAGCGATAGTCGAAGTGGCTC
JMFN028I06- TGCCCGCGTGAGATCCGTGTATGGGCCGGTGTACTACATCAGCGATAGTCGAAGTGGCTC
                      ____________________________________________________________
consensus TGCCCGCGTGAGATCCGTGTATGGGCCGGTGTACTACATCAGCGATAGTCGAAGTGGCTC
 
. : . : . : . : . : . :
JMFS052A11+ CGGCGGGAAACCTTACCGTACCACCGGCCGGCCGTCGTCTACCCCGCTCGCCGGAACTTT
JMFN028I06- CGGCGGGAAACCTTACCGTACCACCGGCCGGCCGTCGTCTACCCCGCTCGCCGGAACTTT
                      ____________________________________________________________
consensus CGGCGGGAAACCTTACCGTACCACCGGCCGGCCGTCGTCTACCCCGCTCGCCGGAACTTT
 
. : . : . : . : . : . :
JMFS052A11+ GAGTCCTTCCGGTAAGGGTGAGGTGGAGATACCGTACGTTAGTCTCAGGGATCTTAACAT
JMFN028I06- GAGTCCTTCCGGTAAGGGTGAGGTGGAGATACCGTACGTTAGTCTCAGGGATCTTAACAT
                      ____________________________________________________________
consensus GAGTCCTTCCGGTAAGGGTGAGGTGGAGATACCGTACGTTAGTCTCAGGGATCTTAACAT
 
. : . : . : . : . : . :
JMFN028I06- GGAGAAGCAGCAGTATTATAGGATGCCTGCACCCTCTTCTACCTTACCAGTCTATTTGGT
                      ____________________________________________________________
consensus GGAGAAGCAGCAGTATTATAGGATGCCTGCACCCTCTTCTACCTTACCAGTCTATTTGGT
 
. : . : . : . : . : . :
JMFN028I06- CACCTAAAANTTAGACTGCTAATTATTGTTGGATTGNATGCTGAGTTGAAATTATACGAC
                      ____________________________________________________________
consensus CACCTAAAANTTAGACTGCTAATTATTGTTGGATTGNATGCTGAGTTGAAATTATACGAC