Previous Contig 002550:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN025L05Sequence586002550 (2)pir|B56555|B565554e-47peroxidase (EC 1.11.1.7), anionic, precursor - wood tobacco
JMFS042E03Sequence610002550 (2)pir|B56555|B565555e-52peroxidase (EC 1.11.1.7), anionic, precursor - wood tobacco

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS042E03+ AGCCATGGTTGAATCTCTT
                      ____________________________________________________________
consensus AGCCATGGTTGAATCTCTT
 
. : . : . : . : . : . :
JMFS042E03+ CTCCCCAGATTCACCGCCCAAGACGGACCTCCCGCCGAAACGACGGCATCACGTGCAGCC
JMFN025L05+ CGCCCAAGACGGACCTCCCGCCGAAACGACGGCATCACGTGCAGCC
                      ____________________________________________________________
consensus CTCCCCAGATTCACCGCCCAAGACGGACCTCCCGCCGAAACGACGGCATCACGTGCAGCC
 
. : . : . : . : . : . :
JMFS042E03+ ACCGTCAATATATCAGCACAAGATACAACACCGGGACAAGATTTCTCGATCTCGCGCTTG
JMFN025L05+ ACCGTCAATATATCAGCACAAGATACAACACCGGGACAAGATTTCTCGATCTCGCGCTTG
                      ____________________________________________________________
consensus ACCGTCAATATATCAGCACAAGATACAACACCGGGACAAGATTTCTCGATCTCGCGCTTG
 
. : . : . : . : . : . :
JMFS042E03+ GCGGCCTCTATCACGTCGTAACCCCTGGCGGAGGCGTTGTTGGGCAACGCATCCTTTTCA
JMFN025L05+ GCGGCCTCTATCACGTCGTAACCCCTGGCGGAGGCGTTGTTGGGCAACGCATCCTTTTCA
                      ____________________________________________________________
consensus GCGGCCTCTATCACGTCGTAACCCCTGGCGGAGGCGTTGTTGGGCAACGCATCCTTTTCA
 
. : . : . : . : . : . :
JMFS042E03+ CCCTCAATGACGGGTGTGCTGTCCAATAAGATGGAAGCGTCGCAACCCTGGACAAAGCAG
JMFN025L05+ CCCTCAATGACGGGTGTGCTGTCCAATAAGATGGAAGCGTCGCAACCCTGGACAAAGCAG
                      ____________________________________________________________
consensus CCCTCAATGACGGGTGTGCTGTCCAATAAGATGGAAGCGTCGCAACCCTGGACAAAGCAG
 
. : . : . : . : . : . :
JMFS042E03+ TCATGGAAATGGAGACGAACCAACGAGGCGGCCATGCGGCGGTCTCGAGAAATCGCCTGG
JMFN025L05+ TCATGGAAATGGAGACGAACCAACGAGGCGGCCATGCGGCGGTCTCGAGAAATCGCCTGG
                      ____________________________________________________________
consensus TCATGGAAATGGAGACGAACCAACGAGGCGGCCATGCGGCGGTCTCGAGAAATCGCCTGG
 
. : . : . : . : . : . :
JMFS042E03+ TTTACGGTGGTGCGAATGATTTTTAGAGCGTTAGGGCATGTCTTGTTGTAAAATGTAGGG
JMFN025L05+ TTTACGGTGGTGCGAATGATTTTTAGAGCGTTAGGGCATGTCTTGTTGTAAAATGTAGGG
                      ____________________________________________________________
consensus TTTACGGTGGTGCGAATGATTTTTAGAGCGTTAGGGCATGTCTTGTTGTAAAATGTAGGG
 
. : . : . : . : . : . :
JMFS042E03+ GACATCTGCGCTTGGCATTGCGAGAATGAGGAGAGCAGCAAAAGAAAACATGATAAAGAT
JMFN025L05+ GACATCTGCGCTTGGCATTGCGAGAATGAGGAGAGCAGCAAAAGAAAACATGATAAAGAT
                      ____________________________________________________________
consensus GACATCTGCGCTTGGCATTGCGAGAATGAGGAGAGCAGCAAAAGAAAACATGATAAAGAT
 
. : . : . : . : . : . :
JMFS042E03+ GCAATAATGCATGGCGTTGTATATATATGAGAAGCCATATATTCTTCCCAGATTGAGATC
JMFN025L05+ GCAATAATGCATGGCGTTGTATATATATGAGAAGCCATATATTCTTCCCAGATTGAGATC
                      ____________________________________________________________
consensus GCAATAATGCATGGCGTTGTATATATATGAGAAGCCATATATTCTTCCCAGATTGAGATC
 
. : . : . : . : . : . :
JMFS042E03+ TAGATGGGGCAAGGACGAATTGAAGGCGGTAGCTATACTGTGTAAAAGATCGGGAAGATT
JMFN025L05+ TAGATGGGGCAAGGACGAATTGAAGGCGGTAGCTATACTGTGTAAAAGATCGGGAAGATT
                      ____________________________________________________________
consensus TAGATGGGGCAAGGACGAATTGAAGGCGGTAGCTATACTGTGTAAAAGATCGGGAAGATT
 
. : . : . : . : . : . :
JMFS042E03+ ATTTTTTTTTGAAAGGCATCGGGGAAGATTATTATTTTTTTTTTTGAAA
JMFN025L05+ ATTTTTTTTTGAAAGGCATCGGGGAAGATTATTATTTTTTTTTTTGAAACCCTGCAGCCC
                      ____________________________________________________________
consensus ATTTTTTTTTGAAAGGCATCGGGGAAGATTATTATTTTTTTTTTTGAAACCCTGCAGCCC