Previous Contig 002546:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008C24Sequence655002546 (2)gb:AF303458_17843491e-47Ipomoea nil PnFL-2 mRNA, complete cds.
JMFN025I14Sequence609002546 (2)gb:AF303458_17843499e-41Ipomoea nil PnFL-2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008C24+ TGCCTTGGGACTGCTCATCATCTG
                      ____________________________________________________________
consensus TGCCTTGGGACTGCTCATCATCTG
 
. : . : . : . : . : . :
JMFN008C24+ GTATGGATAGGGGCCCTTGAAACAATCCTATCCTTTCTCTTCTCAAAGAACCTGGCCAGT
JMFN025I14+ CTGGCCAGT
                      ____________________________________________________________
consensus GTATGGATAGGGGCCCTTGAAACAATCCTATCCTTTCTCTTCTCAAAGAACCTGGCCAGT
 
. : . : . : . : . : . :
JMFN008C24+ GATTTCTTCCTTGCAATAGGCATCTCAGAAGCAATNTGCTGGGGTGGTCTTTGGTTCACA
JMFN025I14+ GATTTCTTCCTGNCAATAGGCATCTCAGAAGCAATTTGCTGGGGTGGTCTTTGGTTCACA
                      ____________________________________________________________
consensus GATTTCTTCCTTGCAATAGGCATCTCAGAAGCAATTTGCTGGGGTGGTCTTTGGTTCACA
 
. : . : . : . : . : . :
JMFN008C24+ AAAGAAGGGACAACCTTTGGAACAGGAGCTGAAGATTCAGGTAGCTTCGGAGCCACCGAG
JMFN025I14+ AAAGAAGGGACAACCTTTGGAACAGGAGCTGAAGATTCAGGTAGCTTCGGAGCCACCGAG
                      ____________________________________________________________
consensus AAAGAAGGGACAACCTTTGGAACAGGAGCTGAAGATTCAGGTAGCTTCGGAGCCACCGAG
 
. : . : . : . : . : . :
JMFN008C24+ GTTGTGCCTCCATTGCTGCTGGCAAGAAGCATGATTTCTTTAGCCTTGTCTGCTGGGAAA
JMFN025I14+ GTTGTGCCTCCATTGCTGCTGGCAAGAAGCATGATTTCTTTAGCCTTGTCTGCTGGGAAA
                      ____________________________________________________________
consensus GTTGTGCCTCCATTGCTGCTGGCAAGAAGCATGATTTCTTTAGCCTTGTCTGCTGGGAAA
 
. : . : . : . : . : . :
JMFN008C24+ TCATTGAACACAATCACTTGCCCACCGTAGAAAATCGTCATTTGTGCCTTTTCTGGGCCA
JMFN025I14+ TCATTGAACACAATCACTTGCCCACCGTAGAAAATCGTCATTTGTGCCTTTTCTGGGCCA
                      ____________________________________________________________
consensus TCATTGAACACAATCACTTGCCCACCGTAGAAAATCGTCATTTGTGCCTTTTCTGGGCCA
 
. : . : . : . : . : . :
JMFN008C24+ GCCTTGGTCACACTTGTGTCCATCTTCTTTGTGGATTCTTCTCTGGTAGGAAACAAGTTC
JMFN025I14+ GCCTTGGTCACACTTGTGTCCATCTTCTTTGTGGATTCTTCTCTGGTAGGAAACAAGTTC
                      ____________________________________________________________
consensus GCCTTGGTCACACTTGTGTCCATCTTCTTTGTGGATTCTTCTCTGGTAGGAAACAAGTTC
 
. : . : . : . : . : . :
JMFN008C24+ ATGGGTTTGTGAACTGAGTTCTGACCCGATTTCTCAATCATTGGCAACAGATCCATTGTG
JMFN025I14+ ATGGGTTTGTGAACTGAGTTCTGACCCGATTTCTCAATCATTGGCAACAGATCCATTGTG
                      ____________________________________________________________
consensus ATGGGTTTGTGAACTGAGTTCTGACCCGATTTCTCAATCATTGGCAACAGATCCATTGTG
 
. : . : . : . : . : . :
JMFN008C24+ GGTCTCGGATTTCCTGAAGGAACAAAATTGCGGGAAAGGCCGAGGCTGAGATCACCGAAG
JMFN025I14+ GGTCTCGGATTTCCTGAAGGAACAAAATTGCGGGAAAGGCCGAGGCTGAGATCACCGAAG
                      ____________________________________________________________
consensus GGTCTCGGATTTCCTGAAGGAACAAAATTGCGGGAAAGGCCGAGGCTGAGATCACCGAAG
 
. : . : . : . : . : . :
JMFN008C24+ GAGCCCTTCTCCTTCAAGTACTGGCTCAGGCGGTTGCAAGTGTGGGAGAAGTTGGACTTC
JMFN025I14+ GAGCCCTTCTCCTTCAAGTACTGGCTCAGGCGGTTGCAAGTGTGGGAGAAGTTGGACTTC
                      ____________________________________________________________
consensus GAGCCCTTCTCCTTCAAGTACTGGCTCAGGCGGTTGCAAGTGTGGGAGAAGTTGGACTTC
 
. : . : . : . : . : . :
JMFN008C24+ TGGCCGGCGAATCTGCCGTAATCTGAAACCTCCGACGAACTCATGTTTCCCGGCGAACGA
JMFN025I14+ TGGCCGGCGAATCTGCCGTAATCTGAAACCTCCGACGAACTCATGTTTCCCGGCGAACGA
                      ____________________________________________________________
consensus TGGCCGGCGAATCTGCCGTAATCTGAAACCTCCGACGAACTCATGTTTCCCGGCGAACGA
 
. : . : . : . : . : . :
JMFN008C24+ TAAAAACCCTTTTCACCAATCTTCTTTAA
JMFN025I14+ TAAAAACCCTTTTCACCAATTTTCTTTAAACTCTAATAATCAATGCTATATTTCCTCCAC
                      ____________________________________________________________
consensus TAAAAACCCTTTTCACCAATTTTCTTTAAACTCTAATAATCAATGCTATATTTCCTCCAC