Previous Contig 002535:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007L15Sequence525002535 (11)gb:AY087157_15721922e-47Arabidopsis thaliana clone 32353 mRNA, complete sequence.715002535 (11)gb:AY087157_15721925e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.
JMFF013A23Sequence504002535 (11)gb:AY087157_15721924e-43Arabidopsis thaliana clone 32353 mRNA, complete sequence.717002535 (11)gb:AY087157_15721925e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.
JMFF015H16Sequence556002535 (11)gb:AY087157_15721923e-47Arabidopsis thaliana clone 32353 mRNA, complete sequence.719002535 (11)gb:AY087157_15721924e-48Arabidopsis thaliana clone 32353 mRNA, complete sequence.
JMFF050M11Sequence634002535 (11)gb:AY087157_15721924e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.588002535 (11)gb:AY087157_15721922e-32Arabidopsis thaliana clone 32353 mRNA, complete sequence.
JMFN020P11Sequence650002535 (11)gb:AY087157_15721924e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.
JMSF048C03Sequence671002535 (11)gb:AY087157_15721924e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.715002535 (11)gb:AY087157_15721925e-54Arabidopsis thaliana clone 32353 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050M11- ACCCTGGAG
                      ____________________________________________________________
consensus ACCCTGGAG
 
. : . : . : . : . : . :
rJMFF050M11- AGTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTTAACAAGGACAAATCTTACAATTACCA
rJMFF013A23- ATTACCA
rJMFF015H16- ATTACCA
                      ____________________________________________________________
consensus AGTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTTAACAAGGACAAATCTTACAATTACCA
 
. : . : . : . : . : . :
rJMFF050M11- TATAACTTACAAAAAGTACCTTTTAACTAGAATCACAGAATTGAAATTATGCAGACAGAA
rJMFF013A23- TATAACTTACAAAAAG-ACCTTTTAACTAGAATCACAGAATTGAAATTATGCAGACAGAA
rJMFF015H16- TATAACTTACAAAAAGTACCTTTTAACTAGAATCACAGAATTGAAATTATGCAGACAGAA
                      ____________________________________________________________
consensus TATAACTTACAAAAAGTACCTTTTAACTAGAATCACAGAATTGAAATTATGCAGACAGAA
 
. : . : . : . : . : . :
rJMFF050M11- CAGAAGATTCATATGTACTACTATTGAATCTGGTGTCATATGCTCAGAGCCATAAGATTT
rJMFF013A23- CAGAAGATTCATATGTACTACTATTGAATCTGGTGTCATATGCTCAGAGCCATAAGATTT
rJMFF015H16- CAGAAGATTCATATGTACTACTATTGAATCTGGTGTCATATGCTCAGAGCCATAAGATTT
rJMSF048C03- ATCTGGTGTCATATGCTCAGAGCCATAAGATTT
rJMFF007L15- ATCTGGTGTCATATGCTCAGAGCCATAAGATTT
                      ____________________________________________________________
consensus CAGAAGATTCATATGTACTACTATTGAATCTGGTGTCATATGCTCAGAGCCATAAGATTT
 
. : . : . : . : . : . :
rJMFF050M11- CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
rJMFF013A23- CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
rJMFF015H16- CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
rJMSF048C03- CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
rJMFF007L15- CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
JMSF048C03+ TATTTGTACTTTGAGCTAAATCTA
                      ____________________________________________________________
consensus CATAGTTTCACACCCAATGGATTATGGCTAAGGTTTTATTTGTACTTTGAGCTAAATCTA
 
. : . : . : . : . : . :
rJMFF050M11- CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
rJMFF013A23- CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
rJMFF015H16- CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
rJMSF048C03- CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
rJMFF007L15- CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
JMFF050M11+ TACAGCCATTCACTTCATGATTATTTCTCTATATNTTATACGAGTTT
JMSF048C03+ CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
JMFN020P11+ TTTTAATACAGCCATTCACTTCATGA-TATTTCTCTATA-TNTATACGAG-TT
                      ____________________________________________________________
consensus CACAACATTTTAATACAGCCATTCACTTCATGATTATTTCTCTATATTTTATACGAGTTT
 
. : . : . : . : . : . :
rJMFF050M11- GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
rJMFF013A23- GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
rJMFF015H16- GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
rJMSF048C03- GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
rJMFF007L15- GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
JMFF050M11+ GTTCAACACTNGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
JMSF048C03+ GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
JMFF015H16+ TGGTTCCCGGCTATAGGGCTGTCTCGCCNTCT
JMFN020P11+ GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
                      ____________________________________________________________
consensus GTTCAACACTTGTCTTAAACAAGGCTACTGGTTCCCGGCTATAGGGCTGTCTCGCCCTCT
 
. : . : . : . : . : . :
rJMFF050M11- CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
rJMFF013A23- CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
rJMFF015H16- CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
rJMSF048C03- CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
rJMFF007L15- CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMFF007L15+ CTTGAAATCGTCCCAACNTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMFF050M11+ CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMSF048C03+ CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMFF015H16+ CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMFF013A23+ CACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
JMFN020P11+ CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
                      ____________________________________________________________
consensus CTTGAAATCGTCCCAACCTCTCACCCACGACTGCCCGGTAGTTGCTCGGGTCTCAGGAGC
 
. : . : . : . : . : . :
rJMFF050M11- AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
rJMFF013A23- AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
rJMFF015H16- AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
rJMSF048C03- AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
rJMFF007L15- AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMFF007L15+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMFF050M11+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMSF048C03+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMFF015H16+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMFF013A23+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
JMFN020P11+ AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
                      ____________________________________________________________
consensus AGCGTGTTTGTCAAGGTTGTTCATGATCTTCGTGTGGACGGAAGTGAACACGGGATTGGT
 
. : . : . : . : . : . :
rJMFF050M11- TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
rJMFF013A23- TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
rJMFF015H16- TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACC-CTTCCACAGATCAGGATTCTC
rJMSF048C03- TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
rJMFF007L15- TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
JMFF007L15+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
JMFF050M11+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
JMSF048C03+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
JMFF015H16+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACC-CTTCCACAGATCAGGATTCTC
JMFF013A23+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
JMFN020P11+ TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
                      ____________________________________________________________
consensus TCTTATTCCATCTGGGGCTGGCTCCTGACCCGTCAACCACTTCCACAGATCAGGATTCTC
 
. : . : . : . : . : . :
rJMFF050M11- CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTC
rJMFF013A23- CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
rJMFF015H16- CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
rJMSF048C03- CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
rJMFF007L15- CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMFF007L15+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMFF050M11+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMSF048C03+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMFF015H16+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMFF013A23+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
JMFN020P11+ CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
                      ____________________________________________________________
consensus CACATCAAGAACATGAACAAGAGCCTTAATTCCAGTTTCATCCATGGAATGGATATGATC
 
. : . : . : . : . : . :
rJMFF013A23- CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
rJMFF015H16- CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
rJMSF048C03- CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
rJMFF007L15- CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMFF007L15+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMFF050M11+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMSF048C03+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMFF015H16+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMFF013A23+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
JMFN020P11+ CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
                      ____________________________________________________________
consensus CTCCACCCATTTGCCCAGAATGAGGTCCAGCTCAAGGTACCCTCTTTGTTTGCTCCTATA
 
. : . : . : . : . : . :
rJMFF013A23- TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
rJMFF015H16- TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
rJMSF048C03- TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
rJMFF007L15- TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMFF007L15+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMFF050M11+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMSF048C03+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMFF015H16+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMFF013A23+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
JMFN020P11+ TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
                      ____________________________________________________________
consensus TAAAAGCCTGTTGACTAACCGCCTTTTGGCTTCTTCATCGGAGAGATCGATACCTAGGTT
 
. : . : . : . : . : . :
rJMFF013A23- AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGG
rJMFF015H16- AGAAGAGCACAAACGCGAGAAAGAAACCAAAAGCGGCCTGTTGGAGG
rJMSF048C03- AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
rJMFF007L15- AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMFF007L15+ AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMFF050M11+ AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMSF048C03+ AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMFF015H16+ AGAAGAGCACAAACGCGAGAAAGAAACCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMFF013A23+ AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
JMFN020P11+ AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
                      ____________________________________________________________
consensus AGAAGAGCACAAACGCGAGAAAGAACCCAAAAGCGGCCTGTTGGAGGGGATCGGTGAAGT
 
. : . : . : . : . : . :
rJMSF048C03- TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
rJMFF007L15- TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMFF007L15+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMFF050M11+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMSF048C03+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMFF015H16+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMFF013A23+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
JMFN020P11+ TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
                      ____________________________________________________________
consensus TTGATTTGTGGGATTAAGGAGAATTCGAGCGAAGGAGGATACAAGAGACCTTCTCGTGAT
 
. : . : . : . : . : . :
rJMSF048C03- CGCCATTGTTTTTCTTTCTTCA
rJMFF007L15- CGCCATTGTTTTTCTTTCTTCA
JMFF007L15+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGT
JMFF050M11+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTT
JMSF048C03+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTTT
JMFF015H16+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTTT
JMFF013A23+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTTT
JMFN020P11+ CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTTTACAGGTCGGAGAAGTTG
                      ____________________________________________________________
consensus CGCCATTGTTTTTCTTTCTTCAAGAAGACAGGCAAAGGAGTTTACAGGTCGGAGAAGTTG