Previous Contig 002529:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013C08Sequence618002529 (18)gb:AY086274_15713271e-55Arabidopsis thaliana clone 23239 mRNA, complete sequence.665002529 (18)gb:AY086274_15713271e-52Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFF019E06Sequence580002529 (18)gb:AY086274_15713274e-51Arabidopsis thaliana clone 23239 mRNA, complete sequence.676002529 (18)gb:AY086274_15713274e-53Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFF025E18Sequence649002529 (18)gb:AY086274_15713273e-52Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFF037K17Sequence584002529 (18)gb:AY086274_15713272e-54Arabidopsis thaliana clone 23239 mRNA, complete sequence.592002529 (18)gb:AY086274_15713271e-41Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFF042I18Sequence630002529 (18)gb:AY086274_15713271e-55Arabidopsis thaliana clone 23239 mRNA, complete sequence.612002529 (18)gb:AY086274_15713271e-50Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFN020C05Sequence641002529 (18)gb:AY086274_15713277e-49Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMFN041J24Sequence505002529 (18)gb:AP003685_18320052e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMSF009J09Sequence432002529 (18)gb:AY086274_15713272e-23Arabidopsis thaliana clone 23239 mRNA, complete sequence.662002529 (18)gb:AY086274_15713273e-53Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMSF009K09Sequence486002529 (18)gb:AY086274_15713271e-34Arabidopsis thaliana clone 23239 mRNA, complete sequence.658002529 (18)gb:AY086274_15713273e-53Arabidopsis thaliana clone 23239 mRNA, complete sequence.
JMSF021B18Sequence685002529 (18)gb:AY086274_15713273e-40Arabidopsis thaliana clone 23239 mRNA, complete sequence.721022962gb:AP003685_18320057e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMSF040A14Sequence668002529 (18)gb:AY086274_15713271e-55Arabidopsis thaliana clone 23239 mRNA, complete sequence.685002529 (18)gb:AY086274_15713273e-55Arabidopsis thaliana clone 23239 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041J24+ AAATGCCAAGT
rJMFF037K17- GT
                      ____________________________________________________________
consensus AAATGCCAAGT
 
. : . : . : . : . : . :
JMFN041J24+ AGAGATCAGAGGAGTATCTAGCAATACAAATACGGTATGAATCGCAGGTCCTTTACATAT
rJMFF037K17- AGAGATCAGAGGAGTATCTAGCAATACAAATACGGTATGAATCGCAGGTCCTTTACATAT
rJMFF042I18- CGGTATGAATCGCAGGTCCTTTACATAT
rJMFF013C08- TCTAGCAATACAAATACGGTATGAATCGCAGGTCCTTTACATAT
rJMSF009J09- T
rJMFF019E06- AGGTCCTTTAC-TAT
                      ____________________________________________________________
consensus AGAGATCAGAGGAGTATCTAGCAATACAAATACGGTATGAATCGCAGGTCCTTTACATAT
 
. : . : . : . : . : . :
JMFN041J24+ CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMFF037K17- CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMFF042I18- CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMFF013C08- CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMSF009J09- CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMSF009K09- ATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMFF025E18- ATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMFF019E06- CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
rJMSF040A14- GTGTACAGAGTA
                      ____________________________________________________________
consensus CAATCACTAGTAATACTTATTGAGCAGACTTATTAACTTAGGATACAAGTGTACAGAGTA
 
. : . : . : . : . : . :
JMFN041J24+ TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMFF037K17- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMFF042I18- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMFF013C08- CTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMSF009J09- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMSF009K09- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMFF025E18- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMFF019E06- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
rJMSF040A14- TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
                      ____________________________________________________________
consensus TTTACAAGAGCAATAAGGCAGGCATCTATGGTGATAGGAGACAATGGAATATACAGAACT
 
. : . : . : . : . : . :
JMFN041J24+ GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMFF037K17- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMFF042I18- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMFF013C08- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMSF009J09- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMSF009K09- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMFF025E18- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMFF019E06- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
rJMSF040A14- GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
                      ____________________________________________________________
consensus GCAAACTTTTTTTGTTTTCTGGTTCCTTAAACTTCACCTTAAAAATGCTGTGGTATATCA
 
. : . : . : . : . : . :
JMFN041J24+ TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMFF037K17- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMFF042I18- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMFF013C08- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMSF009J09- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMSF009K09- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMFF025E18- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMFF019E06- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
rJMSF040A14- TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
JMFF042I18+ TATCTGGATTTGGA
JMFF013C08+ GA
JMSF040A14+ TCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
                      ____________________________________________________________
consensus TCTTCATTGTCATCATCCAAGTCAAAATACTTAAACCCAAGGCTGTTATCTGGATTTGGA
 
. : . : . : . : . : . :
JMFN041J24+ TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMFF037K17- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMFF042I18- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMFF013C08- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMSF009J09- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMSF009K09- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMFF025E18- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMFF019E06- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
rJMSF040A14- TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
JMFF042I18+ TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
JMFF037K17+ GAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
JMFF019E06+ AACAGGTTCAAATTATCCACCAGT
JMFF013C08+ TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
JMSF040A14+ TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
JMFN020C05+ ATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
                      ____________________________________________________________
consensus TTAAAGCTTGAATTCACATAGCATTTCATATCATGAAACAGGTTCAAATTATCCACCAGT
 
. : . : . : . : . : . :
JMFN041J24+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMFF037K17- TTGTGATATATATTGCATCCACAACACTTAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMFF042I18- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMFF013C08- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMSF009J09- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMSF009K09- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMFF025E18- TTGTGATATATATTGCATCCACAACACTGAACAGAGACTGTGCCGTCTGTATAAGCATGA
rJMFF019E06- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
rJMSF040A14- TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMFF042I18+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMFF037K17+ TTGTGATATATATTGCATCCACAACACTTAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMFF019E06+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMSF009K09+ GCATGA
JMFF013C08+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMSF040A14+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMSF021B18+ CTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
JMFN020C05+ TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
                      ____________________________________________________________
consensus TTGTGATATATATTGCATCCACAACACTGAACAAAGACTGTGCCGTCTGTATAAGCATGA
 
. : . : . : . : . : . :
JMFN041J24+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMFF037K17- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMFF042I18- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMFF013C08- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMSF009J09- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMSF009K09- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMFF025E18- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMFF019E06- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
rJMSF040A14- GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMFF042I18+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMFF037K17+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMFF019E06+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMSF009K09+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMSF009J09+ GCAACTAGCATA
JMFF013C08+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMSF040A14+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMSF021B18+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
JMFN020C05+ GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
                      ____________________________________________________________
consensus GGATTGATGGCGCGAGTTGTGCGTTGTCCGCAGACTTTACAAGTGAAGGCAACTAGCATA
 
. : . : . : . : . : . :
JMFN041J24+ CGACGTCGTGGCGA
rJMFF037K17- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMFF042I18- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMFF013C08- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMSF009J09- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMSF009K09- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMFF025E18- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMFF019E06- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
rJMSF040A14- CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMFF042I18+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMFF037K17+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMFF019E06+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMSF009K09+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMSF009J09+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMFF013C08+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMSF040A14+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMSF021B18+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
JMFN020C05+ CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATATCTGCTCCATTCCG
                      ____________________________________________________________
consensus CGACGTCGTGGCGATTTCGTGAAGAGGGACCAAGGGAAGGTAGATACCTGCTCCATTCCG
 
. : . : . : . : . : . :
rJMFF037K17- GTTTCCGGGCTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCC
rJMFF042I18- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMFF013C08- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMSF009J09- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMSF009K09- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMFF025E18- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMFF019E06- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
rJMSF040A14- GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMFF042I18+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMFF037K17+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMFF019E06+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMSF009K09+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMSF009J09+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMFF013C08+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMSF040A14+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMSF021B18+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
JMFN020C05+ GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
                      ____________________________________________________________
consensus GTTTCCGGGTTCGAACCCGCCGGAACCGATGGCCCTTCCATCCCCGACCCGGTAGTCCAT
 
. : . : . : . : . : . :
rJMFF042I18- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCAT
rJMFF013C08- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
rJMSF009J09- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
rJMSF009K09- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
rJMFF025E18- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
rJMFF019E06- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
rJMSF040A14- CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMFF042I18+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMFF037K17+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMFF019E06+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMSF009K09+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMSF009J09+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMFF013C08+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMSF040A14+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMSF021B18+ CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
JMFN020C05+ CCTCGAACGTTCGCCGCGCTC--AACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
                      ____________________________________________________________
consensus CCTCGAACGTTCGCCGCGCTCAGAACCAATCCCATCGCCGCATCCTGGGAAAGGATCGGT
 
. : . : . : . : . : . :
rJMFF013C08- ACCAGGCTCGAGTCATTGGAA
rJMSF009J09- ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
rJMSF009K09- ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
rJMFF025E18- ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
rJMFF019E06- ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
rJMSF040A14- ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMFF042I18+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMFF037K17+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMFF019E06+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMSF009K09+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMSF009J09+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMFF013C08+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMSF040A14+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMSF021B18+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
JMFN020C05+ ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
                      ____________________________________________________________
consensus ACCAGGCTCGAGTCATTGGAATTGGATCGGAGATCGGGCTCGTTCCCGTTACCTCTGGGA
 
. : . : . : . : . : . :
rJMSF009J09- G
rJMFF025E18- G
rJMFF019E06- GA
rJMSF040A14- GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMFF042I18+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMFF037K17+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMFF019E06+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMSF009K09+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMSF009J09+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMFF013C08+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMSF040A14+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMSF021B18+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
JMFN020C05+ GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
                      ____________________________________________________________
consensus GAGGCGGAGAAGCGGAGGATGCGTTTGGAGGAAAGGCGATTGGATTTGAGAGGGGAAAAG
 
. : . : . : . : . : . :
rJMSF040A14- ATTG
JMFF042I18+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMFF037K17+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMFF019E06+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMSF009K09+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMSF009J09+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMFF013C08+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMSF040A14+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMSF021B18+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
JMFN020C05+ ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
                      ____________________________________________________________
consensus ATTGGGAGAGAAGGAGATAGTATGGCGGTTGTTGTTGAGGATGCCAGAGCTTCCATGGTG
 
. : . : . : . : . : . :
JMFF042I18+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
JMFF037K17+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACT
JMFF019E06+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
JMSF009K09+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAAC
JMSF009J09+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAAC
JMFF013C08+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
JMSF040A14+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
JMSF021B18+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
JMFN020C05+ CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
                      ____________________________________________________________
consensus CTCAATAATGGAGTTGAGTCCTTTGGTGGAAAAGCGGAGTAACAGACGGAACTGGGAACA
 
. : . : . : . : . : . :
JMFF042I18+ AGACGAAGAAGAACAC
JMFF019E06+ AGACGAAGAAGAACAC
JMFF013C08+ AGACGAAGAAGAACAC
JMSF040A14+ AGACGAAGAAGAACAC
JMSF021B18+ AGACGAAGAAGAACAC
JMFN020C05+ AGACGAAGAAGAACACGAAGAATATATTGACCGTTCTTATACATATATATGTGGCTCTCG
                      ____________________________________________________________
consensus AGACGAAGAAGAACACGAAGAATATATTGACCGTTCTTATACATATATATGTGGCTCTCG