Previous Contig 002528:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN020B15Sequence626002528 (7)gb:BT002356_16359591e-51Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649
JMFN020L13Sequence617002528 (7)gb:BT002356_16359592e-50Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649
JMFS021G02Sequence614002528 (7)gb:BT002356_16359591e-51Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649
JMSF016M14Sequence232002528 (7)gb:BT002356_16359591e-20Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649624002528 (7)gb:BT002356_16359594e-51Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649
JMSF036C02Sequence621002528 (7)gb:BT002356_16359595e-50Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649572002528 (7)gb:BT002356_16359594e-50Arabidopsis thaliana clone C104996 putative protein kinase C inhibitor (At3g5649

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020L13+ TTTAAAAGTTAAAACTGATAACATTCACAAATTTCCAGTCTGTCATGATTCAGATA
JMSF036C02+ CAAATTTCCAGTCTGTCATGATTCAGATA
JMFS021G02+ AAATTTCCAGTCTGTCATGATTCAGATA
rJMSF016M14- AAATTTCCAGTCTGTCATGATTCAGATA
JMFN020B15+ AAATTTCCAGTCTGTCATGATTCAGATA
                      ____________________________________________________________
consensus TTTAAAAGTTAAAACTGATAACATTCACAAATTTCCAGTCTGTCATGATTCAGATA
 
. : . : . : . : . : . :
JMFN020L13+ GTTTAATTGCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
rJMSF036C02- AGTATCATTCC-GATAAAATGTTCATGCATGATAGATAGCCAATTGACT
JMSF036C02+ GTTTAATTGCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
JMFS021G02+ GTTTAATTGCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
rJMSF016M14- GTTTAATTGCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
JMFN020B15+ GTTTAATGNCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
                      ____________________________________________________________
consensus GTTTAATTGCAAGTATCATTCCAGATAAAATGTTCATGCATGATAGATAGCCAATTGACT
 
. : . : . : . : . : . :
JMFN020L13+ ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
rJMSF036C02- ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
JMSF036C02+ ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
JMFS021G02+ ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
rJMSF016M14- ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
JMFN020B15+ ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
                      ____________________________________________________________
consensus ACCAGCAAGGTTATTTATTTGTAGGGCATAAAGTGCATAAAACTACCCTTATTCTCTGGA
 
. : . : . : . : . : . :
JMFN020L13+ TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
rJMSF036C02- TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
JMSF036C02+ TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
JMFS021G02+ TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
rJMSF016M14- TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
JMFN020B15+ TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
                      ____________________________________________________________
consensus TGATTCTGCTGGGACATCTATCTTCAGGGTCTCTACAATTGCTCAAGTCCAATTAGCCAG
 
. : . : . : . : . : . :
JMFN020L13+ GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
rJMSF036C02- GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
JMSF036C02+ GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
JMFS021G02+ GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
rJMSF016M14- GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
JMFN020B15+ GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
                      ____________________________________________________________
consensus GTGGCCAATTCAATTGACGTCCTCCAATGAGATGAAGGTGAATATGAAAAACAGTTTGGC
 
. : . : . : . : . : . :
JMFN020L13+ CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
rJMSF036C02- CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
JMSF036C02+ CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
JMFS021G02+ CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
rJMSF016M14- CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
JMFN020B15+ CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
                      ____________________________________________________________
consensus CTCCATCTTTTCCATCGTTGATCACAAGCCTGAACCCATTTTCATCGAGACCTTCTTGTT
 
. : . : . : . : . : . :
JMFN020L13+ TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
rJMSF036C02- TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
JMSF036C02+ TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
JMFS021G02+ TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
rJMSF016M14- TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
JMFN020B15+ TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
                      ____________________________________________________________
consensus TGGCTACAAGCTTTGCAGTGTAAAGAAGGCGACCAAGAATCTCGCAATGTCTCTCCTCAG
 
. : . : . : . : . : . :
JMFN020L13+ CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
rJMSF036C02- CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
JMSF036C02+ CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
JMFS021G02+ CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
rJMSF016M14- CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
JMSF016M14+ GGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
JMFN020B15+ CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
                      ____________________________________________________________
consensus CCTTGGAGAGCCCAGTTAAACCATCCTTCACCTTTGGAATAAGAAGAATGTGTGTAGGAG
 
. : . : . : . : . : . :
JMFN020L13+ CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
rJMSF036C02- CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
JMSF036C02+ CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
JMFS021G02+ CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
rJMSF016M14- CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGACCATCCTCGTAAACAATGTTGGCCG
JMSF016M14+ CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGACCATCCTCGTAAACAATGTTGGCCG
JMFN020B15+ CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
                      ____________________________________________________________
consensus CTTTGGGATCTATATCCCTGAAAGCCAAAACCTGATCATCCTCGTAAACAATGTTGGCCG
 
. : . : . : . : . : . :
JMFN020L13+ GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
rJMSF036C02- GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGGAAACGGCGTTT
JMSF036C02+ GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGGAAACGGCGTTT
JMFS021G02+ GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
rJMSF016M14- GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
JMSF016M14+ GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
JMFN020B15+ GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
                      ____________________________________________________________
consensus GAATTTCCTTGTTTATAATCTTGTCAAATATGGTGGGAGAATCGGAGGG-AACGGCGTTT
 
. : . : . : . : . : . :
JMFN020L13+ CCAGAAGCCATGGGAGTGT
rJMSF036C02- CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTC
JMSF036C02+ CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTC
JMFS021G02+ CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTCAGTCGTT
rJMSF016M14- CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTCAGTCGTTGAAGTCGGCT
JMSF016M14+ CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTCAGTCGTTGAAGTCGGCT
JMFN020B15+ CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTCAGTCGTT-AAGTCGGCTGCTG
                      ____________________________________________________________
consensus CCAGAAGCCATGGGAGTGTGAGGAGAGAGATGACTGGTCAGTCGTTGAAGTCGGCTGCTG