Previous Contig 002525:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016G03Sequence625002525 (15)pir|S46306|S463065e-56cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome 678002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFF033I10Sequence606002525 (15)pir|S46306|S463061e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome 722002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFN004C13Sequence273002525 (15)gb:AY578728_16159983e-12Vernicia fordii cytochrome b5 isoform Cb5-B mRNA, complete cds.
JMFN004E02Sequence640002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFN010H02Sequence636002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFN019H12Sequence444002525 (15)pir|S46306|S463063e-41cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFN019P08Sequence648002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMFN035O22Sequence641002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMSF011M10Sequence268002525 (15)gb:AY578728_16159983e-11Vernicia fordii cytochrome b5 isoform Cb5-B mRNA, complete cds.684002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMSF045A08Sequence647002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome 600002525 (15)pir|S46306|S463061e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome
JMSF051E04Sequence666007632 (2)pir|H96573|H965732e-32protein F12M16.29 [imported] - Arabidopsis thaliana>gb:AE005173_893242 Arabidops689002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045A08- AACCA
JMSF045A08+ TTTTTTTTTTGAAGTCACAAAACATGTGTATCCATTACGACAAAACAAACCA
rJMFF016G03- GAAGTCACAAAACATGTGTATCCATTACGACAAAACAAACCA
rJMSF051E04- TCCATTACGACAAAACAAACCA
rJMFF033I10- GAAGTCACAAAACATGTGTATCCATTACGACAAAACAAACCA
                      ____________________________________________________________
consensus TTTTTTTTTTGAAGTCACAAAACATGTGTATCCATTACGACAAAACAAACCA
 
. : . : . : . : . : . :
rJMSF045A08- TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
JMSF045A08+ TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
rJMFF016G03- TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
rJMSF051E04- TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
JMFN035O22+ CAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
JMFN004E02+ TTTGGGTAATGAATTGGAGGTGGGG
JMFN010H02+ TTGGGTAATGAATTGAAGGTGGGG
rJMFF033I10- TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
rJMSF011M10- GATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
                      ____________________________________________________________
consensus TGATTGAGCAGAATAGATGAAAACAAAGAAGTAATTTTGGGTAATGAATTGGAGGTGGGG
 
. : . : . : . : . : . :
rJMSF045A08- GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMSF045A08+ GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
rJMFF016G03- GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
rJMSF051E04- GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFN035O22+ GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFN004E02+ GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFN010H02+ GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
rJMFF033I10- GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFF016G03+ GAGGGGGAAGGGGGGAAGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFF033I10+ CTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
rJMSF011M10- GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
JMFN019P08+ AGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
                      ____________________________________________________________
consensus GGAGGGGGAAGGGGGG-AGCTAATGAATGGAGTAAACTCTTATTCAGATTCCTAGCAGTG
 
. : . : . : . : . : . :
rJMSF045A08- CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMSF045A08+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
rJMFF016G03- CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
rJMSF051E04- CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMFN035O22+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMFN004E02+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMFN010H02+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
rJMFF033I10- CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMFF016G03+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACACCCCAGAATC
JMFF033I10+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
rJMSF011M10- CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
JMFN019P08+ CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
                      ____________________________________________________________
consensus CAAGTGTTTAAGCTGATTGCTTGGTGTAGAAACGGATGCCAACCGCGACA-CCCAGAATC
 
. : . : . : . : . : . :
rJMSF045A08- ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMSF045A08+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
rJMFF016G03- ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
rJMSF051E04- ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFN035O22+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFN004E02+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFN010H02+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
rJMFF033I10- ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFN019H12+ AACTCTGGCGTTTTGTCCTGGTTG
JMFF016G03+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFF033I10+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
rJMSF011M10- ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
JMFN019P08+ ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
                      ____________________________________________________________
consensus ATCAAAGGAAGTAGGAATTGCAAGATCTTGACGAGGAACTCTGGCGTTTTGTCCTGGTTG
 
. : . : . : . : . : . :
rJMSF045A08- TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMSF045A08+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
rJMFF016G03- TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
rJMSF051E04- TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFN035O22+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFN004E02+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFN010H02+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
rJMFF033I10- TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFN019H12+ TAGTAAGGCTGCTTGGGACGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFF016G03+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFF033I10+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
rJMSF011M10- TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
JMFN019P08+ TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
                      ____________________________________________________________
consensus TAGTGAGGCTGCTTGGG-CGGTGTGTACTTGGTGTTGGCGGGAATGGTTGAAGAATCAAT
 
. : . : . : . : . : . :
rJMSF045A08- ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMSF045A08+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
rJMFF016G03- ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
rJMSF051E04- ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFN035O22+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFN004E02+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFN010H02+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
rJMFF033I10- ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFN019H12+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFF016G03+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFF033I10+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
rJMSF011M10- ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
JMFN019P08+ ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
                      ____________________________________________________________
consensus ATCACCCACTAACATCTCATCCAACATTGCCCGGGCGCTGCTGCTGTGGCCAATATCCTC
 
. : . : . : . : . : . :
rJMSF045A08- AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMSF045A08+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
rJMFF016G03- AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
rJMSF051E04- AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN035O22+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN004E02+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN010H02+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
rJMFF033I10- AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN019H12+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN004C13+ AACGTCATCACCCCTTGGATG
JMFF016G03+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFF033I10+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
rJMSF011M10- AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
JMFN019P08+ AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
                      ____________________________________________________________
consensus AAAGTCATCAGTTGCATCCTTTCCGGTTGCTGACAACAAAACGTCATCACCACCTGGATG
 
. : . : . : . : . : . :
rJMSF045A08- ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMSF045A08+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
rJMFF016G03- ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
rJMSF051E04- ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN035O22+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN004E02+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN010H02+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
rJMFF033I10- ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN019H12+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN004C13+ ATATTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCAT
JMFF016G03+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFF033I10+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
rJMSF011M10- ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMSF011M10+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
JMFN019P08+ ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
                      ____________________________________________________________
consensus ATCTTCCAAGAATTTTGTCACATCATATACCTTGCCGCCGATGACAAGCCAGCAGTCCTT
 
. : . : . : . : . : . :
rJMSF045A08- GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMSF045A08+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
rJMFF016G03- GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
rJMSF051E04- GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFN035O22+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFN004E02+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACTCTTTTGGCACCCATTTAGAC
JMFN010H02+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
rJMFF033I10- GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFN019H12+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFN004C13+ GAGTCGGTTGTGCTAGGAGACCTCGGCCAAAGTAAAGACTCTTTTGGCACCCATTTAGAC
JMFF016G03+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFF033I10+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
rJMSF011M10- GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMSF011M10+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
JMFN019P08+ GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
                      ____________________________________________________________
consensus GTTGTGGTTGTGCTCGGAGACCTCGGCCAAAGTAAAGACCCTTTTGGCACCCATTTAGAC
 
. : . : . : . : . : . :
rJMSF045A08- ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTAC
JMSF045A08+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTAC
rJMFF016G03- ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
rJMSF051E04- ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACNAA
JMFN035O22+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFN004E02+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFN010H02+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
rJMFF033I10- ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFN019H12+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFN004C13+ TCGCCGAGAGAAGCAACAAAAAATCGTGTTTGCTAATAAGCAAAATCTAGCAAGTACGAA
JMFF016G03+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFF033I10+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
rJMSF011M10- ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMSF011M10+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
JMFN019P08+ ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
                      ____________________________________________________________
consensus ACGCCGAGAGAAGCAACAAAAAATGGTGTTTGCTAATAAGCAAAATCAAGCAAGTACGAA
 
. : . : . : . : . : . :
rJMFF016G03- GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGA
rJMSF051E04- GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAANAGTTANAGAGAGCAGGANTGATG
JMFN035O22+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFN004E02+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFN010H02+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
rJMFF033I10- GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFN019H12+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFN004C13+ GAAGATATGAAGCTCTTCTAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFF016G03+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFF033I10+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
rJMSF011M10- GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMSF011M10+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
JMFN019P08+ GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
                      ____________________________________________________________
consensus GAAGATCTGAAGCTCTTCAAGCCAGAAAAGCTTGAAGAGTTAGAGAGAGCAGGAATGATG
 
. : . : . : . : . : . :
rJMSF051E04- TGAAGTGTCA
JMFN035O22+ TGAAGTG
JMFN004E02+ TGAAGTGTCAACGTTT
JMFN010H02+ TGAAGTGTCAACGTT
rJMFF033I10- TGAAGTGTCAACGTTTTTTGGTG
JMFN004C13+ T
JMFF016G03+ TGAAGTGTCAACGTTTTTTGGTGAGA
JMFF033I10+ TGAAGTGTCAACGTTTTTTGGTGAGA
rJMSF011M10- TGAAGTGTCAACGTTTTTTGGTGAGA
JMSF011M10+ TGAAGTGTCAACGTTTTTTGGTGAGA
JMFN019P08+ TGAAGTGTCAACGTTTTTTGGTGAGACGAGGAGTGTGGTTGGAATGCTTATGCGAGAAAA
                      ____________________________________________________________
consensus TGAAGTGTCAACGTTTTTTGGTGAGACGAGGAGTGTGGTTGGAATGCTTATGCGAGAAAA