Previous Contig 002516:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016L04Sequence536002516 (6)gb:MSNANN_16871913e-57M.sativa mRNA for annexin-like protein.810002516 (6)gb:AP005904_18598565e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B104
JMFN019B17Sequence626002516 (6)gb:MSNANN_16871919e-74M.sativa mRNA for annexin-like protein.
JMFN040J21Sequence632002516 (6)gb:MSNANN_16871911e-69M.sativa mRNA for annexin-like protein.
JMSF033C02Sequence646002516 (6)gb:MSNANN_16871912e-73M.sativa mRNA for annexin-like protein.726002516 (6)gb:AP005904_18598563e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B104

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016L04- GTTTTTCTAAACATTTTCCGACTTTCCAATGGGCACTTAAATATAG
                      ____________________________________________________________
consensus GTTTTTCTAAACATTTTCCGACTTTCCAATGGGCACTTAAATATAG
 
. : . : . : . : . : . :
rJMFF016L04- ATAAATTTTAGAGGTAGAGATTTAGAAATTACAGAAACAACAAAAGCTTTACACATTCAG
                      ____________________________________________________________
consensus ATAAATTTTAGAGGTAGAGATTTAGAAATTACAGAAACAACAAAAGCTTTACACATTCAG
 
. : . : . : . : . : . :
rJMFF016L04- AAAGCTAATTAAGGTCCAGATCCTAGTTAGCAGTTACTACAATACATTGGGCAAATGCAT
rJMSF033C02- AGATCCTAGTTAGCAGTTACTACAATACATTGGGCAAATGCAT
                      ____________________________________________________________
consensus AAAGCTAATTAAGGTCCAGATCCTAGTTAGCAGTTACTACAATACATTGGGCAAATGCAT
 
. : . : . : . : . : . :
rJMFF016L04- GCTTATTTATTACTGAAATACACAAGATCCTGGTAAATCTTGCACTGCTACACAGTTCTC
rJMSF033C02- GCTTATTTATTACTGAAATACACAAGATCCTGGTAAATCTTGCACTGCTACACAGTTCTC
                      ____________________________________________________________
consensus GCTTATTTATTACTGAAATACACAAGATCCTGGTAAATCTTGCACTGCTACACAGTTCTC
 
. : . : . : . : . : . :
rJMFF016L04- CTAATGATTTGGCCCTAAAAGCAAGAGAAGAAACGCACGATAATGCCCTGAAGTCTCTGA
rJMSF033C02- CTAATGATTTGGCCCTAAAAGCAAGAGAAGAAACGCACGATAATGCCCTGAAGTCTCTGA
                      ____________________________________________________________
consensus CTAATGATTTGGCCCTAAAAGCAAGAGAAGAAACGCACGATAATGCCCTGAAGTCTCTGA
 
. : . : . : . : . : . :
rJMFF016L04- ATGAATCGCATCGTTCAGACTTTTCTTGAATTTCTTGTGGTATTCTCCTTTGATATACTG
rJMSF033C02- ATGAATCGCATCGTTCAGACTTTTCTTGAATTTCTTGTGGTATTCTCCTTTGATATACTG
                      ____________________________________________________________
consensus ATGAATCGCATCGTTCAGACTTTTCTTGAATTTCTTGTGGTATTCTCCTTTGATATACTG
 
. : . : . : . : . : . :
rJMFF016L04- CATGTCAACCTCAGCTCGAGTAACCACTATTCTAATCAGTGTCGAATCTTCTGTCCCCAT
rJMSF033C02- CATGTCAACCTCAGCTCGAGTAACCACTATTCTAATCAGTGTCGAATCTTCTGTCCCCAT
                      ____________________________________________________________
consensus CATGTCAACCTCAGCTCGAGTAACCACTATTCTAATCAGTGTCGAATCTTCTGTCCCCAT
 
. : . : . : . : . : . :
rJMFF016L04- TCCTTTCATTGCCTTGTGCAATGCCTTAGCAAAGTATTTTGCAGGATTCTGGGCACACTG
rJMSF033C02- TCCTTTCATTGCCTTGTGCAATGCCTTAGCAAAGTATTTTGCAGGATTCTGGGCACACTG
                      ____________________________________________________________
consensus TCCTTTCATTGCCTTGTGCAATGCCTTAGCAAAGTATTTTGCAGGATTCTGGGCACACTG
 
. : . : . : . : . : . :
rJMFF016L04- TAAAATAGTCAAGAGGCCAAACTCAAAAAGCCCAGAGGTTTCACTTTTTATTGCCTTCTT
rJMSF033C02- TAAAATAGTCAAGAGGCCAAACTCAAAAAGCCCAGAGGTTTCACTTTTTATTGCCTTCTT
                      ____________________________________________________________
consensus TAAAATAGTCAAGAGGCCAAACTCAAAAAGCCCAGAGGTTTCACTTTTTATTGCCTTCTT
 
. : . : . : . : . : . :
rJMFF016L04- CAATGAGCTGTACGTGTTCTCATAAGCAGAATTAACAGCAGCCAAATGTGCCCTGCTTTT
rJMSF033C02- CAATGAGCTGTACGTGTTCTCATAAGCAGAATTAACAGCAGCCAAATGTGCCCTGCTTTT
JMSF033C02+ TT
JMFN019B17+ AACAGCAGCCAAATGTGCCCTGC-TTT
                      ____________________________________________________________
consensus CAATGAGCTGTACGTGTTCTCATAAGCAGAATTAACAGCAGCCAAATGTGCCCTGCTTTT
 
. : . : . : . : . : . :
rJMFF016L04- CTCGGAGAATATCTGTATAAATTTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
rJMSF033C02- CTCGGAGAATATCTGTATAAATTTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
JMSF033C02+ CTCGGAGAATATCTGTATAAATTTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
JMFN040J21+ AGAATATCTGTATAAA-TTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
JMFN019B17+ CTCGGAGAATATCTGTATAAATTTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
                      ____________________________________________________________
consensus CTCGGAGAATATCTGTATAAATTTCTTCTCGTCAGTCCCTAACTTCTTTTCACCAGCCTT
 
. : . : . : . : . : . :
rJMFF016L04- ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
rJMSF033C02- ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
JMSF033C02+ ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
JMFN040J21+ ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
JMFF016L04+ CATAGCG
JMFN019B17+ ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
                      ____________________________________________________________
consensus ATAGAGCGTTTTAGCATCATGTTGTACTAAAGCTGCATCAACTTCTGGGCCTTCATAGCG
 
. : . : . : . : . : . :
rJMFF016L04- GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGGACTTGAAGATC
rJMSF033C02- GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGAACTTGAAGATC
JMSF033C02+ GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGAACTTGAAGATC
JMFN040J21+ GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGAACTTGAAGATC
JMFF016L04+ GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGGACTTGAAGATC
JMFN019B17+ GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGAACTTGAAGATC
                      ____________________________________________________________
consensus GGGAGTACTAACGTATGCTAGCAGCAACTTTTGGTGATCACCGCTAAGAACTTGAAGATC
 
. : . : . : . : . : . :
rJMFF016L04- ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAA
rJMSF033C02- ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
JMSF033C02+ ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
JMFN040J21+ ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
JMFF016L04+ ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
JMFN019B17+ ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
                      ____________________________________________________________
consensus ATGCTCAAGGTAAGCACCAAACATTGAATGATAGATTTGCTTAAGGTATTGAAGCTGGGC
 
. : . : . : . : . : . :
rJMSF033C02- TGGAGTCCGTGAACATATCACTT
JMSF033C02+ TGGAGTCCGTGAACATATCACTTCAGTGACGGCCTTGTAATCGCTTGTTTCACGCAAACC
JMFN040J21+ TGGAGTCCGTGAACATATCACTTCAGTGACGGCCTTGTAATCGCTTGTTTCACGCAAACC
JMFF016L04+ TGGAGTCCGTGAACATATCACTTCAGTGACGGCCTTGTAATCGCTTGTTTCACGCAAACC
JMFN019B17+ TGGAGTCCGTGAACATATCACTTCAGTGACGGCCTTGTAATCGCTTGTTTCACGCAAACC
                      ____________________________________________________________
consensus TGGAGTCCGTGAACATATCACTTCAGTGACGGCCTTGTAATCGCTTGTTTCACGCAAACC
 
. : . : . : . : . : . :
JMSF033C02+ CTGCCTTATTATAGTAGCATCCCGTCCTGCAGGGTCATGCATCCAAAGTAATACTGCTTT
JMFN040J21+ CTGCCTTATTATAGTAGCATCCCGTCCTGCAGGGTCATGCATCCAAAGTAATACTGCTTT
JMFF016L04+ CTGCCTTATTATAGTAGCATCCCGTCCTGCAGGGTCATGCATCCAAAGTAATACTGCTTT
JMFN019B17+ CTGCCTTATTATAGTAGCATCCCGTCCTGCAGGGTCATGCATCCAAAGTAATACTGCTTT
                      ____________________________________________________________
consensus CTGCCTTATTATAGTAGCATCCCGTCCTGCAGGGTCATGCATCCAAAGTAATACTGCTTT
 
. : . : . : . : . : . :
JMSF033C02+ CTCAACTTTACCGCTAAGCTCAGAAGCCAAACGTTTGGTAAGCTCTTCAGAGTACATAGC
JMFN040J21+ CTCAACTTTACCGCTAAGCTCAGAAGCCAAACGTTTGGTAAGCTCTTCAGAGTACATAGC
JMFF016L04+ CTCAACTTTACCGCTAAGCTCAGAAGCCAAACGTTTGGTAAGCTCTTCAGAGTACATAGC
JMFN019B17+ CTCAACTTTACCGCTAAGCTCAGAAGCCAAACGTTTGGTAAGCTCTTCAGAGTACATAGC
                      ____________________________________________________________
consensus CTCAACTTTACCGCTAAGCTCAGAAGCCAAACGTTTGGTAAGCTCTTCAGAGTACATAGC
 
. : . : . : . : . : . :
JMSF033C02+ TCGATACTCCTGCTGAATAAGAGCGCGTTGTGTGGCATCCCTATGGGCAAGGATATTAAT
JMFN040J21+ TCGATACTCCTGCTGAATAAGAGCGCGTTGTGTGGCATCCCTATGGGCAAGGATATTAAT
JMFF016L04+ TCGATACTCCTGCTGAATAAGAGCGCGTTGTGTGGCATCCCTATGGGCAAGGATATTAAT
JMFN019B17+ TCGATACTCCTGCTGAATAAGAGCGCGTTGTGTGGCATCCCTATGGGCAAGGATATTAAT
                      ____________________________________________________________
consensus TCGATACTCCTGCTGAATAAGAGCGCGTTGTGTGGCATCCCTATGGGCAAGGATATTAAT
 
. : . : . : . : . : . :
JMSF033C02+ CACTGCTGCAGTATCGCACCCGAATCCCTTGAAAGCTTTGTAAAGGTGCATGGCATCGTC
JMFN040J21+ CACTGCTGCAGTATCGCACCCGAATCCCTTGAAAGCTTTGTAAAGGTGCATGGCATCGTC
JMFF016L04+ CACTGCTGCAGTATCGCACCCGAATCCCTTGAAAGCTTTGTAAAGGTGCATGGCATCGTC
JMFN019B17+ CACTGCTGCAGTATCGCACCCGAATCCCTTGAAAGCTTTGTAAAGGTGCATGGCATCGTC
                      ____________________________________________________________
consensus CACTGCTGCAGTATCGCACCCGAATCCCTTGAAAGCTTTGTAAAGGTGCATGGCATCGTC
 
. : . : . : . : . : . :
JMSF033C02+ TCGAGGGGAAGTTAGCACCGGATGAGCACTAAATG
JMFN040J21+ TCGAGGGGAAGTTAGCACCGGATGAGCACTAAATG
JMFF016L04+ TCGAGGGGAAGTTAGCACCGGATGAGCACTAAATG
JMFN019B17+ TCGAGGGGAAGTTAGCACCGGATGAGCACTAAATGTAGCCATAGCTCTCTCTGAATTCTC
                      ____________________________________________________________
consensus TCGAGGGGAAGTTAGCACCGGATGAGCACTAAATGTAGCCATAGCTCTCTCTGAATTCTC