Previous Contig 002510:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018M02Sequence648002510 (3)gb:AK118876_18168302e-54Arabidopsis thaliana At2g46225 mRNA for unknown protein, complete cds, clone: RA
JMSF023B16Sequence702002510 (3)gb:AK118876_18168305e-66Arabidopsis thaliana At2g46225 mRNA for unknown protein, complete cds, clone: RA790002510 (3)gb:AC005397_15326531e-21Arabidopsis thaliana chromosome 2 clone T3F17 map CIC02E07, complete sequence.>g

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023B16- AGACAGGGTAAAGAGTACAACCCTGG
                      ____________________________________________________________
consensus AGACAGGGTAAAGAGTACAACCCTGG
 
. : . : . : . : . : . :
rJMSF023B16- ATTAACACCCAGTTTCAGCTTTACAGCTTATTCATACTGCATGCTTTAATGGAAATGATT
                      ____________________________________________________________
consensus ATTAACACCCAGTTTCAGCTTTACAGCTTATTCATACTGCATGCTTTAATGGAAATGATT
 
. : . : . : . : . : . :
rJMSF023B16- AATCCACTCATTGTACTTCACAGTAGAGTAGAATGAAGTTATACAACACATTACACATAG
                      ____________________________________________________________
consensus AATCCACTCATTGTACTTCACAGTAGAGTAGAATGAAGTTATACAACACATTACACATAG
 
. : . : . : . : . : . :
rJMSF023B16- AAAAGCATCATTTGCTGCCTCACTCACAATATACAATAATTCCTGCACATTATTTTCCCC
                      ____________________________________________________________
consensus AAAAGCATCATTTGCTGCCTCACTCACAATATACAATAATTCCTGCACATTATTTTCCCC
 
. : . : . : . : . : . :
rJMSF023B16- CAAAAAAGAATAAACTGAGTGACATGGTCACATTGACCAATAAGTGTATGATCAAGAAAG
                      ____________________________________________________________
consensus CAAAAAAGAATAAACTGAGTGACATGGTCACATTGACCAATAAGTGTATGATCAAGAAAG
 
. : . : . : . : . : . :
rJMSF023B16- AAGCTAGATTCATGGATCTTGATTAAGGAGGCTGTGGCGTTTAAGTCTGTCTGTCTTTGT
                      ____________________________________________________________
consensus AAGCTAGATTCATGGATCTTGATTAAGGAGGCTGTGGCGTTTAAGTCTGTCTGTCTTTGT
 
. : . : . : . : . : . :
rJMSF023B16- TCACTTTTGGTGTCTTCTGTTTCACAAAGAAAGCTGATAGCATGCTCTTGCTGCGGGTAG
                      ____________________________________________________________
consensus TCACTTTTGGTGTCTTCTGTTTCACAAAGAAAGCTGATAGCATGCTCTTGCTGCGGGTAG
 
. : . : . : . : . : . :
rJMSF023B16- GCACGTGTGTGGTCTCCCGCCGTGGGTGAGGAGGATTATCAAACGATCTATATGGAGTCA
                      ____________________________________________________________
consensus GCACGTGTGTGGTCTCCCGCCGTGGGTGAGGAGGATTATCAAACGATCTATATGGAGTCA
 
. : . : . : . : . : . :
rJMSF023B16- TAGGTTTGGAGCCATCCAGGGCATCCCGCATGACACCCAATGTGTGTGTTGCTATGCTTG
                      ____________________________________________________________
consensus TAGGTTTGGAGCCATCCAGGGCATCCCGCATGACACCCAATGTGTGTGTTGCTATGCTTG
 
. : . : . : . : . : . :
rJMSF023B16- ATCCAGGACCTACACTTGGCGGTTTAGACCAAGCTGGCGAGGCTTTTGTCCTATTGCCCA
                      ____________________________________________________________
consensus ATCCAGGACCTACACTTGGCGGTTTAGACCAAGCTGGCGAGGCTTTTGTCCTATTGCCCA
 
. : . : . : . : . : . :
rJMSF023B16- CTTCACCACCATCCAACAAATTGAATGCACCAGATGTTCTTCCAGAACTTTTTATGTCAT
                      ____________________________________________________________
consensus CTTCACCACCATCCAACAAATTGAATGCACCAGATGTTCTTCCAGAACTTTTTATGTCAT
 
. : . : . : . : . : . :
rJMSF023B16- CAGCACTCACAAAACCACACGAAGCCCCTTTCAAAGTCGATGTGGTTTCTGATGCTAGGT
                      ____________________________________________________________
consensus CAGCACTCACAAAACCACACGAAGCCCCTTTCAAAGTCGATGTGGTTTCTGATGCTAGGT
 
. : . : . : . : . : . :
rJMSF023B16- GCCATGAAAGAGTTTTTGCAGCAGCGGGGCCTGAAGGAAAAAGACGGCCTCTGGATTGTA
JMSF023B16+ TTTTGCAGCAGCGGGNCCTGAAGGAAAAAGACGGCNTCTGGATNGTA
                      ____________________________________________________________
consensus GCCATGAAAGAGTTTTTGCAGCAGCGGGGCCTGAAGGAAAAAGACGGCCTCTGGATTGTA
 
. : . : . : . : . : . :
rJMSF023B16- TATGTTGCCTATGATCCATTTGAATATGGGGGCTAA
JMSF023B16+ TATGTTGCCTATGATCCATTTGAATATGGGGGCTAAAGTGAACCTTCTTGTTGACAGAAT
                      ____________________________________________________________
consensus TATGTTGCCTATGATCCATTTGAATATGGGGGCTAAAGTGAACCTTCTTGTTGACAGAAT
 
. : . : . : . : . : . :
JMSF023B16+ TTGGTAATGTATAATGTTTGTGATGTCTGGGGATGATGGCTAGTAGCTGCTGCTGCCTGA
JMFN018M02+ AATGTCTGTGATGTCTGGGGATGATGGCTAGTAGCTGCTGCTGCCTGA
                      ____________________________________________________________
consensus TTGGTAATGTATAATGTTTGTGATGTCTGGGGATGATGGCTAGTAGCTGCTGCTGCCTGA
 
. : . : . : . : . : . :
JMSF023B16+ AGCCTTCTTTCTCCGTGTATGCTTGACAAGTTAGAAGTTGCTGATTTATACATGTGATCT
JMFN018M02+ AGCCTTCTTTCTCCGTGTATGCTTGACAAGTTAGAAGTTGCTGATTTATACATGTGATCT
                      ____________________________________________________________
consensus AGCCTTCTTTCTCCGTGTATGCTTGACAAGTTAGAAGTTGCTGATTTATACATGTGATCT
 
. : . : . : . : . : . :
JMSF023B16+ TCAACTCCATGGTGGACACATCTAAGTTTTGCTGGCCAACAAGGTCCGTCAATTTGTATG
JMFN018M02+ TCAACTCCATGGTGGACACATCTAAGTTTTGCTGGCCAACAAGGTCCGTCAATTTGTATG
                      ____________________________________________________________
consensus TCAACTCCATGGTGGACACATCTAAGTTTTGCTGGCCAACAAGGTCCGTCAATTTGTATG
 
. : . : . : . : . : . :
JMSF023B16+ CAACAGTGCCTAGGTGGTCAACAGCATTTACAAGGGCTCTTACAGCATAATCTTTTAGGT
JMFN018M02+ CAACAGTGCCTAGGTGGTCAACAGCATTTACAAGGGCTCTTACAGCATAATCTTTTAGGT
                      ____________________________________________________________
consensus CAACAGTGCCTAGGTGGTCAACAGCATTTACAAGGGCTCTTACAGCATAATCTTTTAGGT
 
. : . : . : . : . : . :
JMSF023B16+ TCTCTAGGACCATCTGTTTCTGCTCGCTATGAAGGTAAGACTTTTCACAATATTCAGCAG
JMFN018M02+ TCTCTAGGACCATCTGTTTCTGCTCGCTATGAAGGTAAGACTTTTCACAATATTCAGCAG
                      ____________________________________________________________
consensus TCTCTAGGACCATCTGTTTCTGCTCGCTATGAAGGTAAGACTTTTCACAATATTCAGCAG
 
. : . : . : . : . : . :
JMSF023B16+ CAGAATAAAGCTGGGGCCTCAAGTTCTTAAGTTCCTGTAAGGCTTTGACGAAACTCTTGC
JMFN018M02+ CAGAATAAAGCTGGGGCCTCAAGTTCTTAAGTTCCTGTAAGGCTTTGACGAAACTCTTGC
                      ____________________________________________________________
consensus CAGAATAAAGCTGGGGCCTCAAGTTCTTAAGTTCCTGTAAGGCTTTGACGAAACTCTTGC
 
. : . : . : . : . : . :
JMSF023B16+ TTCGCTCCATGGACACTTCATCGAACGTCATCGCCGAATTGGGCGGCGGCTTTGGCTGCT
JMFN018M02+ TTCGCTCCATGGACACTTCATCGAACGTCATCGCCGAATTGGGCGGCGGCTTTGGCTGCT
                      ____________________________________________________________
consensus TTCGCTCCATGGACACTTCATCGAACGTCATCGCCGAATTGGGCGGCGGCTTTGGCTGCT
 
. : . : . : . : . : . :
JMSF023B16+ CCACCTCCATCTCACTCAACTCGAGATTGAGGGATCGATTGGCAGCGAGAAATGGATGTT
JMFN018M02+ CCACCTCCATCTCACTCAACTCGAGATTGAGGGATCGATTGGCAGCGAGAAATGGATGTT
                      ____________________________________________________________
consensus CCACCTCCATCTCACTCAACTCGAGATTGAGGGATCGATTGGCAGCGAGAAATGGATGTT
 
. : . : . : . : . : . :
JMSF023B16+ TGAGGAAAGTAGAGAGTGAGAAAATTTATGCGGGAAGGTTTGATTAGGGAATAAGGGAGA
JMFN018M02+ TGAGGAAAGTAGAGAGTGAGAAAATTTATGCGGGAAGGTTTGATTAGGGAATAAGGGAGA
                      ____________________________________________________________
consensus TGAGGAAAGTAGAGAGTGAGAAAATTTATGCGGGAAGGTTTGATTAGGGAATAAGGGAGA
 
. : . : . : . : . : . :
JMSF023B16+ TGGTTTAGAGTTTGCAGTTGCAGTAGCAGTAGCGGTGGTGGAGGGGTCTT
JMFN018M02+ TGGTTTAGAGTTTGCAGTTGCAGTAGCAGTAGCGGTGGTGGAGGGGTCTTGATGAATGTG
                      ____________________________________________________________
consensus TGGTTTAGAGTTTGCAGTTGCAGTAGCAGTAGCGGTGGTGGAGGGGTCTTGATGAATGTG
 
. : . : . : . : . : . :
JMFN018M02+ CAATGGAAGCAATGCCGGGAAGTGCATGGAAGCGAAAGTGACGTCGTATTTAATTTCTGG
                      ____________________________________________________________
consensus CAATGGAAGCAATGCCGGGAAGTGCATGGAAGCGAAAGTGACGTCGTATTTAATTTCTGG