Previous Contig 002505:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018I20Sequence521002505 (5)gb:AY050870_15623652e-18Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF007N02Sequence382005138 (5)gb:AY050870_15623655e-26Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete744002505 (5)gb:AY050870_15623652e-88Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF010D08Sequence247005138 (5)692002505 (5)gb:AY050870_15623651e-92Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF013K22Sequence236005138 (5)gb:AY050870_15623657e-07Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete767002505 (5)gb:AY050870_15623651e-91Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF051A13Sequence656005138 (5)gb:AY050870_15623651e-30Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete750002505 (5)gb:AY050870_15623653e-89Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010D08+ TCATTGTAGTAGAGGGTCTGGGCGA
rJMSF051A13+ AGTAGAGGGTCTGGGCGA
rJMSF013K22+ AGTAGAGGGTTTGGGCGA
                      ____________________________________________________________
consensus TCATTGTAGTAGAGGGTCTGGGCGA
 
. : . : . : . : . : . :
rJMSF010D08+ ACGCCACTAGACTGGGATACGAGAATGAAAA-TTGCGTTGTGTGCGGCGAGAGGCCTTGC
rJMSF051A13+ ACGCCACTAGACTGGGATACGAGAATGAAAATTTGCGTTGTGTGCGGCGAGAGGCCTTGC
rJMSF007N02+ GCCACTAGACTGGGATACGAGAATGAAAA-TTGCGTTGTGTGCGGCGAGAGGCCTTGC
rJMSF013K22+ ACGCCACTAGACTGGGATACGAGAATGAAAA-TTGCGTTGTGTGCGGCGAGAGGCCTTGC
                      ____________________________________________________________
consensus ACGCCACTAGACTGGGATACGAGAATGAAAA-TTGCGTTGTGTGCGGCGAGAGGCCTTGC
 
. : . : . : . : . : . :
rJMSF010D08+ GTATCTTCACGCGGGAGGGAAGGTAGTGCATGGCAACATAAAGGCGTCAAATATCTTGCT
rJMSF051A13+ GTATCTTCACGCGGGAGGGAAGGTAGTGCATGGCAACATAAAGGCGTCAAATATCTTGCT
rJMSF007N02+ GTATCTTCACGCGGGAGGGAAGGTAGTGCATGGCAACATAAAGGCGTCAAATATCTTGCT
rJMSF013K22+ GTATCTTCACGCGGGAGGGAAGGTAGTGCATGGCAACATAAAGGCGTCAAATATCTTGCT
                      ____________________________________________________________
consensus GTATCTTCACGCGGGAGGGAAGGTAGTGCATGGCAACATAAAGGCGTCAAATATCTTGCT
 
. : . : . : . : . : . :
rJMSF010D08+ CAAGCAGGACAATCACGAGGCCTGTCTAGCGGATTATGGATTGAACCCGTTGTTTTCCAG
rJMSF051A13+ CAAGCAGGACAATCACGAGGCCTGTCTAGCGGATTATGGATTGAACCCGTTGTTTTCCAG
rJMSF007N02+ CAAGCAGGACAATCACGAGGCCTGTCTAGCGGATTATGGATTGAACCCGTTGTTTTCCAG
rJMSF013K22+ CAAGCAGGACAATCACGAGGCCTGTCTAGCGGATTATGGATTGAACCCGTTGTTTTCCAG
                      ____________________________________________________________
consensus CAAGCAGGACAATCACGAGGCCTGTCTAGCGGATTATGGATTGAACCCGTTGTTTTCCAG
 
. : . : . : . : . : . :
rJMSF010D08+ CTCGACGCCGGTCAACCACAGGGTCGCAGGGTATCGGGCCCCAGAGGTGCTCGAGACCCG
rJMSF051A13+ CTCGACGCCGGTCAACCACAGGGTCGCAGGGTATCGGGCCCCAGAGGTGCTCGAGACCCG
rJMSF007N02+ CTCGACGCCGGTCAACCACAGGGTCGCAGGGTATCGGGCCCCAGAGGTGCTCGAGACCCG
rJMSF013K22+ CTCGACGCCGGTCAACCACAGGGTCGCAGGGTATCGGGCCCCAGAGGTGCTCGAGACCCG
                      ____________________________________________________________
consensus CTCGACGCCGGTCAACCACAGGGTCGCAGGGTATCGGGCCCCAGAGGTGCTCGAGACCCG
 
. : . : . : . : . : . :
rJMSF010D08+ AAAGGTCACGTTTAAGTCAGATGTGTACAGCTACGGGGTTTTGTTGTTGGAGCTTCTAAC
rJMSF051A13+ AAAGGTCACGTTTAAGTCAGATGTGTACAGCTACGGGGTTTTGTTGTTGGAGCTTCTAAC
rJMSF007N02+ AAAGGTCACGTTTAAGTCAGATGTGTACAGCTACGGGGTTTTGTTGTTGGAGCTTCTAAC
rJMSF013K22+ AAAGGTCACGTTTAAGTCAGATGTGTACAGCTACGGGGTTTTGTTGTTGGAGCTTCTAAC
                      ____________________________________________________________
consensus AAAGGTCACGTTTAAGTCAGATGTGTACAGCTACGGGGTTTTGTTGTTGGAGCTTCTAAC
 
. : . : . : . : . : . :
rJMSF010D08+ GGGCAAATCGCCCAACCAGGCTTCGTTAGGCGAGGAGGGCATTGATTTGCCCCGATGGGT
rJMSF051A13+ GGGCAAATCGCCCAACCAGGCTTCGTTAGGCGAGGAGGGCATTGATTTGCCCCGATGGGT
rJMSF007N02+ GGGCAAATCGCCCAACCAGGCTTCGTTAGGCGAGGAGGGCATTGATTTGCCCCGATGGGT
rJMSF013K22+ GGGCAAATCGCCCAACCAGGCTTCGTTAGGCGAGGAGGGCATTGATTTGCCCCGATGGGT
                      ____________________________________________________________
consensus GGGCAAATCGCCCAACCAGGCTTCGTTAGGCGAGGAGGGCATTGATTTGCCCCGATGGGT
 
. : . : . : . : . : . :
rJMSF010D08+ TCAAAGCGTCGTTAGGGAGGAATGGACCGCCGAAGTGTTTGATGTCGAGNTAATGAGGTA
rJMSF051A13+ TCAAAGCGTCGTTAGGGAGGAATGGACCGCCGAAGTGTTTGATGTCGAGCTAATGAGGTA
rJMSF007N02+ TCAAAGCGTCGTTAGGGAGGAATGGACCGCCGAAGTGTTTGATGTCGAGCTAATGAGGTA
rJMSF013K22+ TCAAAGCGTCGTTAGGGAGGAATGGACCGCCGAAGTGTTTGATGTCGAGCTAATGAGGTA
                      ____________________________________________________________
consensus TCAAAGCGTCGTTAGGGAGGAATGGACCGCCGAAGTGTTTGATGTCGAGCTAATGAGGTA
 
. : . : . : . : . : . :
rJMSF010D08+ TCACAATGTGGAAGAAGAGATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
rJMSF051A13+ TCACAATGTGGAAGAAGAGATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
rJMSF007N02+ TCACAATGTGGAAGAAGAGATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
rJMSF013K22+ TCACAATGTGGAAGAAGAGATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
JMFN018I20+ GATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
                      ____________________________________________________________
consensus TCACAATGTGGAAGAAGAGATGGTGCAACTACTCCAGATTGGAATGGCATGTGTTGCCAT
 
. : . : . : . : . : . :
rJMSF010D08+ GGTTCCCGACCAGAGACCCTNGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
rJMSF051A13+ GGTTCCCGACCAGAGACCCTCGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
rJMSF007N02+ GGTTCCCGACCAGAGACCCTCGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
rJMSF013K22+ GGTTCCCGACCAGAGACCCTCGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
JMFN018I20+ GGTTCCCGACCAGAGACCCTCGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
                      ____________________________________________________________
consensus GGTTCCCGACCAGAGACCCTCGATGCCGGATGTGGTGAGGATGATGGAGGAGATAAACCG
 
. : . : . : . : . : . :
rJMSF010D08+ CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
rJMSF051A13+ CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
rJMSF007N02+ CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
rJMSF013K22+ CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
JMFN018I20+ CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
                      ____________________________________________________________
consensus CGGGGGCGAAACGGACGATGGATTGCGACGACAATCCTCCGATGATCCATCGAAAGGGTC
 
. : . : . : . : . : . :
rJMSF010D08+ CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
rJMSF051A13+ CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
rJMSF007N02+ CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
rJMSF013K22+ CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
JMFN018I20+ CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
                      ____________________________________________________________
consensus CGACATCCAAACACCTCCTCAGGAACCCCGAGCTTCACCTCCATAGGATCAAAGCAAAAC
 
. : . : . : . : . : . :
rJMSF010D08+ AACATAAG
rJMSF051A13+ AACATAAGCTATTGTTGAAATCTGCTGGAAGGCTATTCAGTCAAGTATATTACTTCCATT
rJMSF007N02+ AACATAAGCTATTGTTGAAATCTGCTGGAAGGCTATTCAGTCAAGTATATTACTTCCA-T
rJMSF013K22+ AACATAAGCTATTGTTGAAATCTGCTGGAAGGCTATTCAGTCAAGTATATTACTTCCATT
JMFN018I20+ AACATAAGCTATTGTTGAAATTTGCTGGAAGGCTATTCAGTCAAGTATATTACTTCCA-T
                      ____________________________________________________________
consensus AACATAAGCTATTGTTGAAATCTGCTGGAAGGCTATTCAGTCAAGTATATTACTTCCATT
 
. : . : . : . : . : . :
rJMSF051A13+ TTTTT
rJMSF007N02+ TTTTTTGTTTTCCTTTTTTCAAGAAAAT
rJMSF013K22+ TTTTTTGTTTTCCTTTTTTCAAGAAAAT
JMFN018I20+ TTTTTTGTTTTCCTTTTTTCAAGAAAATTGTGCAGTGAAATTGATAGAGATAATGGTAGT
                      ____________________________________________________________
consensus TTTTTTGTTTTCCTTTTTTCAAGAAAATTGTGCAGTGAAATTGATAGAGATAATGGTAGT
 
. : . : . : . : . : . :
JMFN018I20+ TTGCAGGAGGAAAAAAAAAAAAAAAAGAGTGTTGAATATGAAGTGATTGGAGTTGACCAT
                      ____________________________________________________________
consensus TTGCAGGAGGAAAAAAAAAAAAAAAAGAGTGTTGAATATGAAGTGATTGGAGTTGACCAT
 
. : . : . : . : . : . :
JMFN018I20+ TTGATGTATTCAGTTGTTCCTTTTATCATCTGATTCTTTTTGTTCAAAAACTTTATTAAG
                      ____________________________________________________________
consensus TTGATGTATTCAGTTGTTCCTTTTATCATCTGATTCTTTTTGTTCAAAAACTTTATTAAG
 
. : . : . : . : . : . :
JMFN018I20+ AATATATGCTTCTTTGCATTTGGCCTXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus AATATATGCTTCTTTGCATTTGGCCTNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC