Previous Contig 002503:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049C21Sequence476002503 (3)226002503 (3)
JMFN018I12Sequence551002503 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049C21- AAAACACA
                      ____________________________________________________________
consensus AAAACACA
 
. : . : . : . : . : . :
JMFF049C21- CAGGCTCTCAAATCCTAGACATATCTTCCAAACGAAAATATTCTCCTACTTTCAGACAAA
                      ____________________________________________________________
consensus CAGGCTCTCAAATCCTAGACATATCTTCCAAACGAAAATATTCTCCTACTTTCAGACAAA
 
. : . : . : . : . : . :
JMFF049C21- TTAAGGTTTCTGAAATGGCGAGGTTTGCATTCTGTTACGCAGTGATTCTTGGAGTGCTGG
JMFN018I12+ TGGAGTGCTGG
                      ____________________________________________________________
consensus TTAAGGTTTCTGAAATGGCGAGGTTTGCATTCTGTTACGCAGTGATTCTTGGAGTGCTGG
 
. : . : . : . : . : . :
JMFF049C21- TGGTGGAAGCCATGGCGGCCGGATCTGCAGATTCGGAGGCGTACCCAAGGAAGCTTATGG
JMFN018I12+ TGGTGGAAGCCATGGCGGCCGGATCTGCAGATTCGGAGGCGTACCCAAGGAAGCTTATGG
                      ____________________________________________________________
consensus TGGTGGAAGCCATGGCGGCCGGATCTGCAGATTCGGAGGCGTACCCAAGGAAGCTTATGG
 
. : . : . : . : . : . :
JMFF049C21- CCAACAGATCATTGTTGTCAACACTACAGCAGAGTAGAACAGAGAGAAGCGCGGCAGATC
JMFN018I12+ CCAACAGATCATTGTTGTCAACACTACAGCAGAGTAGAACAGAGAGAAGCGCGGCAGATC
                      ____________________________________________________________
consensus CCAACAGATCATTGTTGTCAACACTACAGCAGAGTAGAACAGAGAGAAGCGCGGCAGATC
 
. : . : . : . : . : . :
JMFF049C21- CGCCGCTTCCCGGCGCCGCCCAGGAGTCGCCTTCCGAAGGAAAAGGAGAGGCCGGAGCTC
JMFN018I12+ CGCCGCTTCCCGGCGCCGCCCAGGAGTCGCCTTCCGAAGGAAAAGGAGAGGCCGGAGCTC
                      ____________________________________________________________
consensus CGCCGCTTCCCGGCGCCGCCCAGGAGTCGCCTTCCGAAGGAAAAGGAGAGGCCGGAGCTC
 
. : . : . : . : . : . :
JMFF049C21- CGGAGAGTCTGGAAACGGCGGAGCACCACCACTCTGATAAGTCGGTTGCTGGTGGAGGAG
JMFN018I12+ CGGAGAGTCTGGAAACGGCGGAGCACCACCACTCTGATAAGTCGGTTGCTGGTGGAGGAG
                      ____________________________________________________________
consensus CGGAGAGTCTGGAAACGGCGGAGCACCACCACTCTGATAAGTCGGTTGCTGGTGGAGGAG
 
. : . : . : . : . : . :
JMFF049C21- TCATCATCGGCGGGCTTGCCACCGCCATTATCGCCGCTGTCTATTGCTACATTCGCGTCA
rJMFF049C21+ ACCGCCATTATCGCCGCTGTTTATTGCTACATTCGCGTCA
JMFN018I12+ TCATCATCGGCGGGCTTGCCACCGCCATTATCGCCGCTGTCTATTGCTACATTCGCGTCA
                      ____________________________________________________________
consensus TCATCATCGGCGGGCTTGCCACCGCCATTATCGCCGCTGTCTATTGCTACATTCGCGTCA
 
. : . : . : . : . : . :
JMFF049C21- CACGTAAAAGAGTAGATGGTGATCAAAGAAGCGTGTATTGATTTTTCT
rJMFF049C21+ CACGTAAAAGAGTAGATGGTGATCAAAGAAGCGTGTATTGATTTTTCTTTATTTTTGGGA
JMFN018I12+ CACGTAAAAGAGTAGATGGTGATCAAAGAAGCGTGTATTGATTTTTCTTTATTTTTTGGA
                      ____________________________________________________________
consensus CACGTAAAAGAGTAGATGGTGATCAAAGAAGCGTGTATTGATTTTTCTTTATTTTTTGGA
 
. : . : . : . : . : . :
rJMFF049C21+ GAGGTAAAAAGTTATATTAAAAACAAAAAAAGAGTACGTGAATAGAATAGGTAGATTAGG
JMFN018I12+ GAGGTAAAAAGTTATATTAAAAACAAAAAAAGAGTACGTGAATAGAATAGTTAGATTAGG
                      ____________________________________________________________
consensus GAGGTAAAAAGTTATATTAAAAACAAAAAAAGAGTACGTGAATAGAATAGTTAGATTAGG
 
. : . : . : . : . : . :
rJMFF049C21+ GTAGAATTATTGGCCTATGGTGTAAGTAGTAGATGGAAAATTAATGCAGCATAAGAAAAT
JMFN018I12+ TTAGAATTATTGGCCTATGGTGTAAGTAGTAGATGGAAAATTAATGCAGCATAAGAAAAT
                      ____________________________________________________________
consensus TTAGAATTATTGGCCTATGGTGTAAGTAGTAGATGGAAAATTAATGCAGCATAAGAAAAT
 
. : . : . : . : . : . :
rJMFF049C21+ TATTT
JMFN018I12+ TATTTATGGTTCGCCTTGAATGTTTATTTGAAAATAAGGATATTTATTATTGCTTGCTGT
                      ____________________________________________________________
consensus TATTTATGGTTCGCCTTGAATGTTTATTTGAAAATAAGGATATTTATTATTGCTTGCTGT