Previous Contig 002502:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044L03Sequence520002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha519002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFN018D17Sequence496002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMFS155D03Sequence481002502 (7)pir|T50532|T505326e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMSF024G13Sequence502002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha443002502 (7)pir|T50532|T505325e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha
JMSF044C01Sequence505002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha709002631 (5)gb:AC105729_17380053e-50Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044L03- AAGTAGCTACAGATGCATGTGCTAGTAAAAACTGAAT
JMSF024G13+ TGCTAGTAAAAACTGAAT
JMFS155D03+ AGTAAAAACTGAAT
JMFF044L03+ ACAATCAAGTAGCTACAGATGCATGTGCTAGTAAAAACTGAAT
JMSF044C01+ TGCTAGTAAAAACTGAAT
JMFN018D17+ CTAGTAAAAACTGAAT
                      ____________________________________________________________
consensus ACAATCAAGTAGCTACAGATGCATGTGCTAGTAAAAACTGAAT
 
. : . : . : . : . : . :
rJMFF044L03- CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
JMSF024G13+ CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
JMFS155D03+ CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
rJMSF024G13- AACGCCGCAAATCTGAAACG
JMFF044L03+ CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
JMSF044C01+ CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
JMFN018D17+ CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
                      ____________________________________________________________
consensus CTTTCATTCAATAACATAATCTGTCAGATGCATAATTTCAAACGCCGCAAATCTGAAACG
 
. : . : . : . : . : . :
rJMFF044L03- TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
JMSF024G13+ TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
JMFS155D03+ TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
rJMSF024G13- TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
JMFF044L03+ TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
JMSF044C01+ TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
JMFN018D17+ TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
                      ____________________________________________________________
consensus TGAGTCTTAAAACAAATAAAATATCTATCAGAACTCAAAAATTAGGCATATCAGTTCCCC
 
. : . : . : . : . : . :
rJMFF044L03- ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
JMSF024G13+ ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
JMFS155D03+ ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
rJMSF024G13- ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
JMFF044L03+ ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
JMSF044C01+ ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
JMFN018D17+ ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
                      ____________________________________________________________
consensus ATTAAACTTCAAACAGAAACAGGACAACGGTCTGTTATTAGTCACCCTTTCTTCTGAAAG
 
. : . : . : . : . : . :
rJMFF044L03- AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
JMSF024G13+ AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
JMFS155D03+ AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
rJMSF024G13- AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
JMFF044L03+ AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
JMSF044C01+ AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
JMFN018D17+ AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
                      ____________________________________________________________
consensus AGCATCCCTCTGTGAGCCTGGCACGCCCACCAGTCGGCTGGCACAACACTGTCTGGCAGT
 
. : . : . : . : . : . :
rJMFF044L03- TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
JMSF024G13+ TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
JMFS155D03+ TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
rJMSF024G13- TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
JMFF044L03+ TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
JMSF044C01+ TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
JMFN018D17+ TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
                      ____________________________________________________________
consensus TCCCACACACCACAACTGTCTGGGAGTGACTGAACACAGTTGTTATGTTAAAGCAGCCTT
 
. : . : . : . : . : . :
rJMFF044L03- GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
JMSF024G13+ GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
JMFS155D03+ GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
rJMSF024G13- GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
JMFF044L03+ GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
JMSF044C01+ GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
JMFN018D17+ GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
                      ____________________________________________________________
consensus GGCACTTGACATCCATGAAGAAAGAGTTGGGAGACTGCACGAGACGCTTGAGCTTGTGCT
 
. : . : . : . : . : . :
rJMFF044L03- TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
JMSF024G13+ TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
JMFS155D03+ TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
rJMSF024G13- TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
JMFF044L03+ TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
JMSF044C01+ TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
JMFN018D17+ TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
                      ____________________________________________________________
consensus TCTTCTTCTCGAGCTCGGCAGGAGGGTTCAACAAATCGATGTCGTTCGGTAGAACCATTG
 
. : . : . : . : . : . :
rJMFF044L03- TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCTAGC
JMSF024G13+ TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCT
JMFS155D03+ TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAG
rJMSF024G13- TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCT
JMFF044L03+ TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCTAGC
JMSF044C01+ TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCTAGC
JMFN018D17+ TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCTAGCAAA
                      ____________________________________________________________
consensus TGTTGATGAACGAAAACCCTAGAACGCAAGCTGACGATAAGTTGAAGCTCCGCTAGCAAA