Previous Contig 002495:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017K14Sequence519002495 (3)gb:AP004235_18390957e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P000
JMSF032K10Sequence651019720730002495 (3)gb:AP004235_18390954e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P000
JMSF033K10Sequence137002495 (3)gb:AP004235_18390950.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P000

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032K10+ TATCCGAGAAATTCAATATTNCCCGTTGAGTTCAACCCGGTGCCG
                      ____________________________________________________________
consensus TATCCGAGAAATTCAATATTNCCCGTTGAGTTCAACCCGGTGCCG
 
. : . : . : . : . : . :
rJMSF032K10+ GTTTTTGCCCCACAAGTCACCCGGGAAATGCTCGATATAAGGCCCGGCGAGGCGCTGGCG
                      ____________________________________________________________
consensus GTTTTTGCCCCACAAGTCACCCGGGAAATGCTCGATATAAGGCCCGGCGAGGCGCTGGCG
 
. : . : . : . : . : . :
rJMSF033K10+ TCCANCACACCCCGGACGAGAGCGTTGACGTGAGCAATCCT
rJMSF032K10+ GTGAACTTCCCGTTACAGCTCCACCACACCCCGGACGAGAGCGTTGACGTGAGCAATCCT
                      ____________________________________________________________
consensus GTGAACTTCCCGTTACAGCTCCACCACACCCCGGACGAGAGCGTTGACGTGAGCAATCCT
 
. : . : . : . : . : . :
rJMSF033K10+ CGAGACGGACTTCTAAGGATGGTGAAGTCGCTCTCTCCCAAGGTGGTCNCGTTGGTGGAG
rJMSF032K10+ CGAGACGGACTTCTAAGGATGGTGAAGTCGCTCTCTCCCAAGGTGGTCACGTTGGTGGAG
                      ____________________________________________________________
consensus CGAGACGGACTTCTAAGGATGGTGAAGTCGCTCTCTCCCAAGGTGGTCACGTTGGTGGAG
 
. : . : . : . : . : . :
rJMSF033K10+ CANGAATCGAACACGAAC
rJMSF032K10+ CAAGAATCGAACACGAACACCGCCCCCTTCTTCAGCAGGTTCATCGAAGCTCTGGAATAC
                      ____________________________________________________________
consensus CAAGAATCGAACACGAACACCGCCCCCTTCTTCAGCAGGTTCATCGAAGCTCTGGAATAC
 
. : . : . : . : . : . :
rJMSF032K10+ TACTCAGCCATGTTCGAGTCACTGGACGTGGTCCTACCGAGGGACAGGAAGGAGCGCATC
JMFN017K14- CTGGACGTGGTCCTACCGAGGGACAGGAAGGAGCGCATC
                      ____________________________________________________________
consensus TACTCAGCCATGTTCGAGTCACTGGACGTGGTCCTACCGAGGGACAGGAAGGAGCGCATC
 
. : . : . : . : . : . :
rJMSF032K10+ AACGTCGAGCAGCACTGCCTGGCCCGAG-ACATAGTGAACGTGATAGCTTGCGAGGGCAA
JMFN017K14- AACGTCGAGCAGCACTGCCTGGCCCGAGCACATAGTGAACGTGATAGCTTGCGAGGGCAA
                      ____________________________________________________________
consensus AACGTCGAGCAGCACTGCCTGGCCCGAGCACATAGTGAACGTGATAGCTTGCGAGGGCAA
 
. : . : . : . : . : . :
rJMSF032K10+ GGAGAGGGTGGAGCGCCACGAGCTGTTAGGGAAGTGGAAATCGAGGTTCACCATGGCAGG
JMFN017K14- GGAGAGGGTGGAGCGCCACTAGCTGTTAGGGAAGTGGAAATCGAGGTTCACCATGGCAGG
                      ____________________________________________________________
consensus GGAGAGGGTGGAGCGCCACTAGCTGTTAGGGAAGTGGAAATCGAGGTTCACCATGGCAGG
 
. : . : . : . : . : . :
rJMSF032K10+ ATTTCAACAGTATCCCCTAAGCTCTTACGTCAATTCGGTAATCAAGGGCCTGTTAAAGTG
JMFN017K14- ATTTCAACAGTATCCCCTAAGCTGTTACGTCAATTCGGTAATCAAGGGCCTGTTAAAGTG
                      ____________________________________________________________
consensus ATTTCAACAGTATCCCCTAAGCTGTTACGTCAATTCGGTAATCAAGGGCCTGTTAAAGTG
 
. : . : . : . : . : . :
rJMSF032K10+ TTACTCTGAGCATTACACTCTTGTGGAGAAAGATGGGGCTATGCTATTGGGATGGAAGGA
JMFN017K14- TTACTCTGAGCATTACACTCTTGTGGAGAAAGATGGGGCTATGCTATTGGGATGGAAGGA
                      ____________________________________________________________
consensus TTACTCTGAGCATTACACTCTTGTGGAGAAAGATGGGGCTATGCTATTGGGATGGAAGGA
 
. : . : . : . : . : . :
rJMSF032K10+ TAGAAACCTCATCTCTGCTTCTGCTTGGCACTGAAACTAAGTCATACAAAAAACATATAC
JMFN017K14- TAGAAACCTCATCTTTGCTTCTGCTTGGCACTGAAACTAAGTCATACAAAAAACATATAC
                      ____________________________________________________________
consensus TAGAAACCTCATCTTTGCTTCTGCTTGGCACTGAAACTAAGTCATACAAAAAACATATAC
 
. : . : . : . : . : . :
rJMSF032K10+ TCAGAACTAGAAAGAACCTATTTTGTGTTGTCCTGGGATGAACACAGACACAAAGATTTC
JMFN017K14- TCAGAACTAGAAAGAACCTATTTTGTTTTGTCCTGGGATGAACACAGACACAAAGATTTC
                      ____________________________________________________________
consensus TCAGAACTAGAAAGAACCTATTTTGTTTTGTCCTGGGATGAACACAGACACAAAGATTTC
 
. : . : . : . : . : . :
rJMSF032K10+ TTGTTGCAAACATGCACTTAGAAAAT
JMFN017K14- TTGTTGCAAACATGCACTTACAAAATTTATGATGTTGGTAATTGAAATACATTTCATTTG
                      ____________________________________________________________
consensus TTGTTGCAAACATGCACTTAGAAAATTTATGATGTTGGTAATTGAAATACATTTCATTTG
 
. : . : . : . : . : . :
JMFN017K14- TACCTGTAAATTGCAAGAATTAATCATTTATAATACATGGTAATCTTGGTATAGATTTGT
                      ____________________________________________________________
consensus TACCTGTAAATTGCAAGAATTAATCATTTATAATACATGGTAATCTTGGTATAGATTTGT