Previous Contig 002489:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004F23Sequence217005461 (5)745002489 (11)gb:AF466824_18023703e-87Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.
JMFF017A16Sequence406005461 (5)gb:AB009053_15107008e-20Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.>gb:AF466198_18021670002489 (11)gb:AB009053_15107003e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.>gb:AF466198_18021
JMFF023D24Sequence266008089 (2)713002489 (11)gb:AF466824_18023701e-85Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.
JMFF031A14Sequence438001840 (2)gb:AC093018_17358264e-20Oryza sativa chromosome 3 BAC OSJNBb0081B07 genomic sequence, complete sequence.683002489 (11)gb:AF466824_18023706e-62Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.
JMFF043D07Sequence625001840 (2)gb:AB009053_15107002e-51Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.>gb:AF466198_18021517002489 (11)gb:AF466824_18023703e-58Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.
JMFN017H05Sequence527002489 (11)gb:AJ843123_18145083e-23Plantago major partial mRNA for putative xanthine/uracil permease (xup1 gene).
JMSF004G23Sequence162005461 (5)388002489 (11)gb:AJ843123_18145084e-27Plantago major partial mRNA for putative xanthine/uracil permease (xup1 gene).
JMSF014E10Sequence210005461 (5)803002489 (11)gb:AB009053_15107005e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.>gb:AF466198_18021
JMSF022I11Sequence746002489 (11)gb:AF466824_18023703e-95Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.
JMSF046E18Sequence106002489 (11)gb:AJ843123_18145084e-10Plantago major partial mRNA for putative xanthine/uracil permease (xup1 gene).
JMSF050G11Sequence171005461 (5)766002489 (11)gb:AF466824_18023707e-75Arabidopsis thaliana clone GBGe55 putative permease 1 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022I11+ GGAACCGGATCTTCTGTATCTATTGAGAATGCTGGACT
rJMSF014E10+ TGAGAATGCTGGACT
                      ____________________________________________________________
consensus GGAACCGGATCTTCTGTATCTATTGAGAATGCTGGACT
 
. : . : . : . : . : . :
rJMSF022I11+ TCTAGCGCTTACTCGAGTGGGGAGTCGAAGAGTTGTTCAGATATCCGCGGGATTCATGAT
rJMFF023D24+ AGTCGAAGAGTAGTCCAGATATCTGCTGGGTTCATGAT
rJMFF004F23+ TTACTCGAGTGGGGAGTCGAAGAGTTGTTCAGATATCCGCGGGATTCATGAT
rJMSF014E10+ TCTAGCGCTTACTCGAGT-GGGAGTCGAAGAGTTGTTCAGATATCCGC-GGATTCATGAT
                      ____________________________________________________________
consensus TCTAGCGCTTACTCGAGTGGGGAGTCGAAGAGTTGTTCAGATATCCGCGGGATTCATGAT
 
. : . : . : . : . : . :
rJMSF022I11+ TTTCTTCTCTATTCTTGGAAAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
rJMFF017A16+ ATTCTTGGAAAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
rJMFF023D24+ TTTCTTTTCTATTCTTGGCAAATTTGGAGCCATCTTTGCTTCGATACCAGCACCAATAGT
rJMFF004F23+ TTTCTTCTCTATTCTTGGAAAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
rJMSF014E10+ TTTCTTCTCTATTCTTGGAAAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
rJMSF050G11+ AAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
                      ____________________________________________________________
consensus TTTCTTCTCTATTCTTGGAAAATTCGGAGCAGTCTTTGCTTCGATTCCAGCACCCATTGT
 
. : . : . : . : . : . :
rJMSF022I11+ GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
rJMFF017A16+ GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
rJMFF043D07+ AGTTTGCTTCA
rJMFF023D24+ AGCCGCGTTATATTGTCTGTTCTTCGGTTATGTCGGTGCGGGGGGCTTAAGCTTCCTTCA
rJMFF004F23+ GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
rJMSF014E10+ GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
rJMFF031A14+ ATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
rJMSF050G11+ GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
                      ____________________________________________________________
consensus GGCTGCTTTATATTGCCTGTTCTTTGGATATGTAGGTGCTGGAGGCGTGAGTTTGCTTCA
 
. : . : . : . : . : . :
rJMSF022I11+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMFF017A16+ ATTCTGCAACCCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMFF043D07+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMFF023D24+ GTTCTGCAA-TCTGAATAGTTTCCGAACCAAGTTCATACTAGGCTTTTCAATCTTTCTCG
rJMFF004F23+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMSF014E10+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMFF031A14+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
rJMSF050G11+ ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
                      ____________________________________________________________
consensus ATTCTGCAA-CCTGAATAGTTTCCGGAACAAGTTCATACTCGGGTTTTCAATCTTTCTCG
 
. : . : . : . : . : . :
rJMSF022I11+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMFF017A16+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMFF043D07+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMFF023D24+ GTTTATCCGTCCCTCAATACTTCAACGAGTACACAGTCATCGCTGGCTATGGACCCGTCC
rJMFF004F23+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMSF014E10+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMFF031A14+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
rJMSF050G11+ GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
                      ____________________________________________________________
consensus GATTGTCTATCCCTCAGTACTTCAACGAGTACATTGCCATCAATAGTTATGGACCTGTTC
 
. : . : . : . : . : . :
rJMSF022I11+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMFF017A16+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMFF043D07+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMSF004G23+ ATCGAAAGCTTTTG
rJMFF023D24+ ATACAAGCGGGAGATGGTTCAACGACATTGTGAACGTGCCATTCTCGTCGGAGGCTTTTG
rJMFF004F23+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMSF014E10+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMFF031A14+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
rJMSF050G11+ ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
                      ____________________________________________________________
consensus ACACTGGCGGGAGATGGTTCAACGACATTGTGAATGTTCCGTTTTCATCGAAAGCTTTTG
 
. : . : . : . : . : . :
rJMSF022I11+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMFF017A16+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAGACCAGGTCA
rJMFF043D07+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMSF004G23+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMFF023D24+ TGGCGGGGATTCTGGCGTATTTCTTGGACAACACGATGCAC---AGGGATCATCAAATAA
rJMFF004F23+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMSF014E10+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMFF031A14+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMSF050G11+ TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
rJMSF046E18+ TTAGACANCNCGATGCACAAGAAGGAAANCCAGGTCA
JMFN017H05- TGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
                      ____________________________________________________________
consensus TTGCGGGGATTGTGGCGTATTTCTTAGACACCACGATGCACAAGAAGGAAAACCAGGTCA
 
. : . : . : . : . : . :
rJMSF022I11+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMFF017A16+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMFF043D07+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMSF004G23+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMFF023D24+ GGAGGGACCGAGGCAAGCATTGGTGGGACAAGTTCAGGTCTTTCAAAACCGATACCCGAA
rJMFF004F23+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMSF014E10+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMFF031A14+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMSF050G11+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
rJMSF046E18+ GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACANGAA
JMFN017H05- GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
                      ____________________________________________________________
consensus GGAAAGACCGAGGCAAGCATTGGTGGGACAAGTTCCGGTCTTTCAAGACCGACACAAGAA
 
. : . : . : . : . : . :
rJMSF022I11+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMFF017A16+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMFF043D07+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMSF004G23+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMFF023D24+ GCGAGGAATTCTACTCCCTCCCGTTCAACCTCAACAAGTATTTCCCGTC
rJMFF004F23+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMSF014E10+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMFF031A14+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMSF050G11+ GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
rJMSF046E18+ GCGAAGA
JMFN017H05- GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
                      ____________________________________________________________
consensus GCGAAGAATTCTACTCCCTCCCTTTCAACCTCAACAAATACTTCCCGTCCGTCTGAATCT
 
. : . : . : . : . : . :
rJMSF022I11+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMFF017A16+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMFF043D07+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMSF004G23+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMFF004F23+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMSF014E10+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMFF031A14+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
rJMSF050G11+ CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
JMFN017H05- CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
                      ____________________________________________________________
consensus CGCTACACCCAAGTAAGACCTCGTTTTCTCATCGAATCATCTCGTCGCCTCGTCGGGCTT
 
. : . : . : . : . : . :
rJMSF022I11+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMFF017A16+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMFF043D07+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMSF004G23+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMFF004F23+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMSF014E10+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMFF031A14+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
rJMSF050G11+ CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
JMFN017H05- CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
                      ____________________________________________________________
consensus CGAAAAGCCATACTTGGGGCCTCCTGCAACACAGTTTTCCTTTGCTTATGTATCCCTTTT
 
. : . : . : . : . : . :
rJMSF022I11+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCT
rJMFF017A16+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
rJMFF043D07+ GGATGTGAAAAAAGGTTACTATAAATA
rJMSF004G23+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
rJMFF004F23+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
rJMSF014E10+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
rJMFF031A14+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
rJMSF050G11+ GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
JMFN017H05- GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
                      ____________________________________________________________
consensus GGATGTGAAAAAA-GTTACTATAAATAGTCTGACAGCTTGGAGGATGCTTAATTAGAACA
 
. : . : . : . : . : . :
rJMFF017A16+ TTTGTTGATTAGGGTTTTTCT
rJMSF004G23+ TTTGTNGNTTAGGGT
rJMFF004F23+ TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATT
rJMSF014E10+ TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATTTGTTGGTTATTATGAACAACATTTC
rJMFF031A14+ TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATTTGTTGGTTATTATGAACAACATTTC
rJMSF050G11+ TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATTTGTTGGTTATTATGAACAACATTTC
JMFN017H05- TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATTTGTTGGTTATTATGAACAACATTTC
                      ____________________________________________________________
consensus TTTGTTGATTAGGGTTTTTCTTTTTAGTGTAAATTTGTTGGTTATTATGAACAACATTTC
 
. : . : . : . : . : . :
rJMSF014E10+ TCTGCAACTCTA
rJMFF031A14+ TCTGCAACTCTAGCACTGTTAAATGCCCCTGAAAAATGGAGACAATAATCCA
rJMSF050G11+ TCTGCAACTCTAGCACTGTTAAATGCCCCTGAAAAATGGAGACAATAATCCAATGGCCTC
JMFN017H05- TCTGCAACTCTAGCACTGTTAAATGCCCCTGAAAAATGGAGACAATAATCCAATGGCCTC
                      ____________________________________________________________
consensus TCTGCAACTCTAGCACTGTTAAATGCCCCTGAAAAATGGAGACAATAATCCAATGGCCTC
 
. : . : . : . : . : . :
JMFN017H05- TGAAAGGCTAACATATCCACCACATAGCCTTTAAGTATGGTTATAAACAACGGTTAGCGC
                      ____________________________________________________________
consensus TGAAAGGCTAACATATCCACCACATAGCCTTTAAGTATGGTTATAAACAACGGTTAGCGC