Previous Contig 002488:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017G22Sequence603002488 (3)gb:AB016880_15130381e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG10.
JMFN033N17Sequence630002488 (3)gb:AB016880_15130381e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG10.
JMFS043D10Sequence609002488 (3)gb:AB016880_15130381e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG10.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033N17+ CATAATTCATTAGGTAAGGATACAATAGTACAATACATATGATGATTTA
                      ____________________________________________________________
consensus CATAATTCATTAGGTAAGGATACAATAGTACAATACATATGATGATTTA
 
. : . : . : . : . : . :
JMFN033N17+ ATTAATTGGTATATATGTATTGGATCGATCTGGCCTGGGTACACATGCATACAGCGAGCA
                      ____________________________________________________________
consensus ATTAATTGGTATATATGTATTGGATCGATCTGGCCTGGGTACACATGCATACAGCGAGCA
 
. : . : . : . : . : . :
JMFN033N17+ AAGTGGTTCTGNAAAGCATGCAATTAAGCAGCAGCTAGCTAGCCCCGCAATTCATGCATG
                      ____________________________________________________________
consensus AAGTGGTTCTGNAAAGCATGCAATTAAGCAGCAGCTAGCTAGCCCCGCAATTCATGCATG
 
. : . : . : . : . : . :
JMFN033N17+ TTGAAAGAAGCTAAGGAAGATGATTATATTGTTCATCCAATATATTCGCAGTCAGTGTTG
JMFS043D10+ TATTCGCAGTCAGTGTTG
JMFN017G22+ TATTCGCAGTCAGTGTTG
                      ____________________________________________________________
consensus TTGAAAGAAGCTAAGGAAGATGATTATATTGTTCATCCAATATATTCGCAGTCAGTGTTG
 
. : . : . : . : . : . :
JMFN033N17+ GGATCAATTATGAAGCCAAGAGAGACACCGCAGAAGCCGGGGAGTGTGGCAATGGAAGTG
JMFS043D10+ GGATCAATTATGAAGCCAAGAGAGACACCGCAGAAGCCGGGGAGTGTGGCAATGGAAGTG
JMFN017G22+ GGATCAATTATGAAGCCAAGAGAGACACCGCAGAAGCCGGGGAGTGTGGCAATGGAAGTG
                      ____________________________________________________________
consensus GGATCAATTATGAAGCCAAGAGAGACACCGCAGAAGCCGGGGAGTGTGGCAATGGAAGTG
 
. : . : . : . : . : . :
JMFN033N17+ GCGTTGGGGTTGTAAGTGGTGATGAGGTCCATGACGCATCTGCACACGATCTGGCGGTTG
JMFS043D10+ GCGTTGGGGTTGTAAGTGGTGATGAGGTCCATGACGCATCTGCACACGATCTGGCGGTTG
JMFN017G22+ GCGTTGGGGTTGTAAGTGGTGATGAGGTCCATGACGCATCTGCACACGATCTGGCGGTTG
                      ____________________________________________________________
consensus GCGTTGGGGTTGTAAGTGGTGATGAGGTCCATGACGCATCTGCACACGATCTGGCGGTTG
 
. : . : . : . : . : . :
JMFN033N17+ TCGGTGGAGTCAGCGAGGTTGCTGAGGCTGAGCATGGCGACGCAGCAAGGAGAACCAGGG
JMFS043D10+ TCGGTGGAGTCAGCGAGGTTGCTGAGGCTGAGCATGGCGACGCAGCAAGGAGAACCAGGG
JMFN017G22+ TCGGTGGAGTCAGCGAGGTTGCTGAGGCTGAGCATGGCGACGCAGCAAGGAGAACCAGGG
                      ____________________________________________________________
consensus TCGGTGGAGTCAGCGAGGTTGCTGAGGCTGAGCATGGCGACGCAGCAAGGAGAACCAGGG
 
. : . : . : . : . : . :
JMFN033N17+ ATGGGGTCCGGCGATCCGTACATCACGAAGCTCGAACAAGCTGATACTAGTGCCTTCACC
JMFS043D10+ ATGGGGTCCGGCGATCCGTACATCACGAAGCTCGAACAAGCTGATACTAGTGCCTTCACC
JMFN017G22+ ATGGGGTCCGGCGATCCGTACATCACGAAGCTCGAACAAGCTGATACTAGTGCCTTCACC
                      ____________________________________________________________
consensus ATGGGGTCCGGCGATCCGTACATCACGAAGCTCGAACAAGCTGATACTAGTGCCTTCACC
 
. : . : . : . : . : . :
JMFN033N17+ GTTGCACAGTCTATCCCTCCTTGCTGCTCTGACGACGATTCCACCCCAATTCTCCGCCTG
JMFS043D10+ GTTGCACAGTCTATCCCTCCTTGCTGCTCTGACGACGATTCCACCCCAATTCTCCGCCTG
JMFN017G22+ GTTGCACAGTCTATCCCTCCTTGCTGCTCTGACGACGATTCCACCCCAATTCTCCGCCTG
                      ____________________________________________________________
consensus GTTGCACAGTCTATCCCTCCTTGCTGCTCTGACGACGATTCCACCCCAATTCTCCGCCTG
 
. : . : . : . : . : . :
JMFN033N17+ CTTGTTGATAATAATATCACCATCATCATCACCGCCACTGAACCACAATATTTCAAACTC
JMFS043D10+ CTTGTTGATAATAATATCACCATCATCATCACCGCCACTGAACCACAATATTTCAAACTC
JMFN017G22+ CTTGTTGATAATAATATCACCATCATCATCACCGCCACTGAACCACAATATTTCAAACTC
                      ____________________________________________________________
consensus CTTGTTGATAATAATATCACCATCATCATCACCGCCACTGAACCACAATATTTCAAACTC
 
. : . : . : . : . : . :
JMFN033N17+ ACTATCTCCTCCAATTTCACTATCTTCATTATATATTATTA
JMFS043D10+ ACTATCTCCTCCAATTTCACTATCTTCATTATATATTATTATTATTATTATTATTATTAC
JMFN017G22+ ACTATCTCCTCCAATTTCACTATCTTCATTATATATTATTATTATTATTATTATTATTAC
                      ____________________________________________________________
consensus ACTATCTCCTCCAATTTCACTATCTTCATTATATATTATTATTATTATTATTATTATTAC
 
. : . : . : . : . : . :
JMFS043D10+ AACATTATAATAATACAGGATATATATATATTATATATATACTGTTAATTGGAATAATAA
JMFN017G22+ AACATTATAATAATACAGGATATATATATATTATATATATACTGTTAATTGGAATAATAA
                      ____________________________________________________________
consensus AACATTATAATAATACAGGATATATATATATTATATATATACTGTTAATTGGAATAATAA