Previous Contig 002484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012M11Sequence564002484 (11)gb:AY037209_15601033e-69Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143670002484 (11)gb:AY037209_15601039e-54Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMFF024D12Sequence516002484 (11)gb:AY037209_15601032e-55Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143711002484 (11)gb:AY037209_15601034e-62Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMFF024F02Sequence522002484 (11)pir|T50787|T507872e-49hypothetical protein T30N20_50 - Arabidopsis thaliana>gb:ATT30N20_1555796 Arabid611002484 (11)gb:AY037209_15601033e-54Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMFF044L10Sequence594002484 (11)gb:AY037209_15601036e-67Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143558002484 (11)gb:AY037209_15601033e-29Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMFN013A02Sequence622002484 (11)gb:AY037209_15601035e-66Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMFN016O08Sequence619002484 (11)gb:AY037209_15601037e-31Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143
JMSF033P20Sequence640019782gb:AY070078_15667202e-70Arabidopsis thaliana unknown protein (At3g46200) mRNA, complete cds.>gb:AY117353690002484 (11)gb:AY037209_15601031e-55Arabidopsis thaliana AT5g10780/T30N20_50 mRNA, complete cds.>gb:AY057731_1564143

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF012M11- ATCACCACCATTGCTTTACGACGGAGA
JMFF024D12- ATCACCACCATTGCTTTACGACGGAGA
JMFF024F02- ATCACCACCATTGCTTTACGACGGAGA
JMFF044L10- AATTGAGACAAGACGAGATCGACGACATCACCACCATTGCTTTACGACGGAGA
JMFN013A02- CTTTACGACGGAGA
rJMFF024D12+ ATCACCACCATTGCTTTACGACGGAGA
                      ____________________________________________________________
consensus AATTGAGACAAGACGAGATCGACGACATCACCACCATTGCTTTACGACGGAGA
 
. : . : . : . : . : . :
JMFF012M11- TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCAGATGGNCCGTCGACTTCACCGACA
JMFF024D12- TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCA-ATGGGCCGTCGACTTCACCGACA
JMFF024F02- TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCA-ATGGGCCGTCGACTTCACCGACA
JMFF044L10- TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCAGATGGGCCGTCGACTTCACCGACA
JMFN013A02- TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCATATGGGCCGTCGACTTCACCGACA
rJMFF024D12+ TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCA-ATGGGCCGTCGACTTCACCGACA
rJMSF033P20+ CA
                      ____________________________________________________________
consensus TGGAGAAGGGAAAAGCAGTGATGGGTATGGGCCGCA-ATGGGCCGTCGACTTCACCGACA
 
. : . : . : . : . : . :
JMFF012M11- ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
JMFF024D12- ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
JMFF024F02- ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
JMFF044L10- ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
JMFN013A02- ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
rJMFF024D12+ ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
rJMFF024F02+ CTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
rJMSF033P20+ ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
rJMFF012M11+ CGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
                      ____________________________________________________________
consensus ATTCAACCTCCCCTTCCTCTCGCGACATCCCCGACCCTCCTGGCTTCACTCGCGCTTCTC
 
. : . : . : . : . : . :
JMFF012M11- AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAANAACGCCGAATCTAATTGGAAAT
JMFF024D12- AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
JMFF024F02- AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
JMFF044L10- AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
JMFN013A02- AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
rJMFF024D12+ AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
rJMFF024F02+ AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
rJMSF033P20+ AAGATCAGGACGATTTAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
rJMFF012M11+ AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
                      ____________________________________________________________
consensus AAGATCAGGACGATTCAACAGTGAGTCGTGAGAAGAAGAACGCCGAATCTAATTGGAAAT
 
. : . : . : . : . : . :
JMFF012M11- CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
JMFF024D12- CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
JMFF024F02- CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
JMFF044L10- CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
JMFN013A02- CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
rJMFF024D12+ CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
rJMFF024F02+ CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
rJMSF033P20+ CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
rJMFF012M11+ CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
JMFN016O08+ ATTTGATGATGATGGGCTTTA
                      ____________________________________________________________
consensus CTCAGAAAGCATGGGAAGTGGCACAAGCACCTTTCAAGAATTTGATGATGATGGGCTTTA
 
. : . : . : . : . : . :
JMFF012M11- TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
JMFF024D12- TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
JMFF024F02- TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
JMFF044L10- TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
JMFN013A02- TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
rJMFF024D12+ TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
rJMFF024F02+ TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
rJMSF033P20+ TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
rJMFF012M11+ TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
rJMFF044L10+ AGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
JMFN016O08+ TGATGTGGATGGCTGNAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
                      ____________________________________________________________
consensus TGATGTGGATGGCTGGAAGCACAGTTCATTTATTTAGCATTGGGATCACATTTTCTGCTC
 
. : . : . : . : . : . :
JMFF012M11- TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
JMFF024D12- TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
JMFF024F02- TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
JMFF044L10- TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
JMFN013A02- TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
rJMFF024D12+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
rJMFF024F02+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
rJMSF033P20+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
rJMFF012M11+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
rJMFF044L10+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
JMFN016O08+ TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
                      ____________________________________________________________
consensus TTTGGCAGCCCATAAGTGCTCTCCAAGGTGTTGGGAAAGTTTTTGAGCCTTACAAGGATA
 
. : . : . : . : . : . :
JMFF012M11- GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
JMFF024D12- GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
JMFF024F02- GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
JMFF044L10- GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
JMFN013A02- GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
rJMFF024D12+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
rJMFF024F02+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
rJMSF033P20+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
rJMFF012M11+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
rJMFF044L10+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
JMFN016O08+ GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
                      ____________________________________________________________
consensus GTAAAGTGGATCTCCTGGGGCCAAAATTACTATTCATTGCCTTAAATTTGGCTGGTTTAG
 
. : . : . : . : . : . :
JMFF012M11- NGATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
JMFF024D12- -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
JMFF024F02- -GATTGGGCATCTGGAAGCTTAATACCTTGGGGTCTTCTTCCAAGTCATCCATCTGACTG
JMFF044L10- -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
JMFN013A02- -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
rJMFF024D12+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
rJMFF024F02+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
rJMSF033P20+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
rJMFF012M11+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
rJMFF044L10+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
JMFN016O08+ -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
                      ____________________________________________________________
consensus -GATTGGGCATCTGGAAGCTTAATACCTT-GGGTCTTCTTCCAAGTCATCCATCTGACTG
 
. : . : . : . : . : . :
JMFF012M11- GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGA
JMFF024D12- GGTCTCTTCCTT
JMFF024F02- GGTCTCTTCCTTGCCAC
JMFF044L10- GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
JMFN013A02- GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
rJMFF024D12+ GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
rJMFF024F02+ GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
rJMSF033P20+ GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
rJMFF012M11+ GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
rJMFF044L10+ GGTTTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTTTGGTGGGGGTATGCCTCGATA
JMFN016O08+ GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
                      ____________________________________________________________
consensus GGTCTCTTCCTTGCCACCTGCCCAGGAGGTTGAGTATTCTGGTGGGGGTATGCCTCGATA
 
. : . : . : . : . : . :
JMFF044L10- TTA
JMFN013A02- TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
rJMFF024D12+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
rJMFF024F02+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
rJMSF033P20+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
rJMFF012M11+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
rJMFF044L10+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
JMFN016O08+ TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
                      ____________________________________________________________
consensus TTAAGACTCTGCCAGACAAGTTGCAGGTCAGAGATTTGGTTGTTAGGGCAGAGAATTTGC
 
. : . : . : . : . : . :
JMFN013A02- AGCCCTTCTC
rJMFF024D12+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
rJMFF024F02+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
rJMSF033P20+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
rJMFF012M11+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
rJMFF044L10+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
JMFN016O08+ AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
                      ____________________________________________________________
consensus AGCCCTTCTCAAGTGACATTATACATTCTCTGGTTGTACTAGTACTCAAGAAAAGAGTTT
 
. : . : . : . : . : . :
rJMFF024D12+ CATTTTGGAGTGCTTGTATTTGTAGAC
rJMFF024F02+ CATTTTGGAGTGCTTGTATTTGTAGACTC
rJMSF033P20+ CATTTTGGAGTGCTTGTATTTGTAGACTCTTCAATAGTTTTGGGATTTATTTATGGAACT
rJMFF012M11+ CATTTTGGAGTGCTTGTATTTGTAGACTCTTCAATAGTTTTGGGATTTATTTATGGAACT
rJMFF044L10+ CATTTTGGAGTGCTTGTATTTGTAGACTCTTCAATAGTTTTGGGATTTATTTATGGAACT
JMFN016O08+ CATTTTGGAGTGCTTGTATTTGTAGACTCTTCAATAGTTTTGGGATTTATTTATGGAACT
                      ____________________________________________________________
consensus CATTTTGGAGTGCTTGTATTTGTAGACTCTTCAATAGTTTTGGGATTTATTTATGGAACT
 
. : . : . : . : . : . :
rJMSF033P20+ TTGTTAACGGATTATAAGCTTTACGATCAT
rJMFF012M11+ TTGTTAACGGATTATAAGCTTTACGATCAT
rJMFF044L10+ TTGTTAACGGATTATAAGCTTTACGATCATCATGAAGGTTATAACTTTGATC
JMFN016O08+ TTGTTAACGGATTATAAGCTTTACGATCATCATGAAGGTTATAACTTTGATCAAACTACG
                      ____________________________________________________________
consensus TTGTTAACGGATTATAAGCTTTACGATCATCATGAAGGTTATAACTTTGATCAAACTACG
 
. : . : . : . : . : . :
JMFN016O08+ AAATCCAAACAATTCTCGTATGTXXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus AAATCCAAACAATTCTCGTATGTNNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC