Previous Contig 002482:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016N18Sequence577002482 (3)gb:AY087960_15729847e-38Arabidopsis thaliana clone 39922 mRNA, complete sequence.>gb:BT004039_1637151 Ar
JMSF037B21Sequence641002482 (3)gb:AY087960_15729849e-64Arabidopsis thaliana clone 39922 mRNA, complete sequence.>gb:BT004039_1637151 Ar614002482 (3)gb:AY087960_15729843e-57Arabidopsis thaliana clone 39922 mRNA, complete sequence.>gb:BT004039_1637151 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037B21- GGCGGAGAATACTGACATTCTTCTATTAATCAGCAGGAGTTTCGTTGTCTAAGAT
                      ____________________________________________________________
consensus GGCGGAGAATACTGACATTCTTCTATTAATCAGCAGGAGTTTCGTTGTCTAAGAT
 
. : . : . : . : . : . :
JMSF037B21- TCAATGTCGGTCAGAACAGTGAAAGTAAGCAATGCTTCTTTAGGTGCTTCTGAGCAAGAT
                      ____________________________________________________________
consensus TCAATGTCGGTCAGAACAGTGAAAGTAAGCAATGCTTCTTTAGGTGCTTCTGAGCAAGAT
 
. : . : . : . : . : . :
JMSF037B21- ATCAAGGAGTTCTTTTCGTTTTCTGGAGATATTGAGTATGTGGAAATGAAAAGTGCTGAT
                      ____________________________________________________________
consensus ATCAAGGAGTTCTTTTCGTTTTCTGGAGATATTGAGTATGTGGAAATGAAAAGTGCTGAT
 
. : . : . : . : . : . :
JMSF037B21- GAACGGTCTCAAATTGCTTATGTGACTTTCAAGGATCCTCAGGGTGCAGAGACTGCTGTG
                      ____________________________________________________________
consensus GAACGGTCTCAAATTGCTTATGTGACTTTCAAGGATCCTCAGGGTGCAGAGACTGCTGTG
 
. : . : . : . : . : . :
JMSF037B21- CTTCTTTCAGGAGCTACTATTGTTGATCAATCAGTCACTATAACTCTCGATCCCGAATAC
                      ____________________________________________________________
consensus CTTCTTTCAGGAGCTACTATTGTTGATCAATCAGTCACTATAACTCTCGATCCCGAATAC
 
. : . : . : . : . : . :
JMSF037B21- AAGCTTCCACCTCAGGCTTTATCAACACCAATTGTTGCTGAAAGCCAGAATGTGGGTGGT
                      ____________________________________________________________
consensus AAGCTTCCACCTCAGGCTTTATCAACACCAATTGTTGCTGAAAGCCAGAATGTGGGTGGT
 
. : . : . : . : . : . :
JMSF037B21- GATGGATCTGGATCTGGATCTGCAATCCAGAAGGCGGAAGATGTTGTGAGCAGCATGTTG
rJMSF037B21+ ATCTGCAATCCAGAAGGCGGAAGATGTTGTGAGCAGCATGTTG
                      ____________________________________________________________
consensus GATGGATCTGGATCTGGATCTGCAATCCAGAAGGCGGAAGATGTTGTGAGCAGCATGTTG
 
. : . : . : . : . : . :
JMSF037B21- GCCAAGGGTTTTATCCTGGGCAAAGATGCAGTTAACAAAGCCAAGTCTTCTGATGAGAAG
rJMSF037B21+ GCCAAGGGTTTTATCCTGGGCAAAGATGCAGTTAACAAAGCCAAGTCTTCTGATGAGAAG
                      ____________________________________________________________
consensus GCCAAGGGTTTTATCCTGGGCAAAGATGCAGTTAACAAAGCCAAGTCTTCTGATGAGAAG
 
. : . : . : . : . : . :
JMSF037B21- CACCAGTTCACTTCCACTGCCACGGCCAAAGTTGCAGCTTTGGACCAAAAGATTGGATTC
rJMSF037B21+ CACCAGTTCACTTCCACTGCCACGGCCAAAGTTGCAGCTTTGGACCAAAAGATTGGATTC
JMFN016N18+ GGCCAAAGTTGCAGCTTTGGACCAAAAGATTGGATTC
                      ____________________________________________________________
consensus CACCAGTTCACTTCCACTGCCACGGCCAAAGTTGCAGCTTTGGACCAAAAGATTGGATTC
 
. : . : . : . : . : . :
JMSF037B21- ACTGAGAAAATTGGGTTGGGAGCGAACATTGTGAATGAAAAGGTTAAAGAAGTGGACCAG
rJMSF037B21+ ACTGAGAAAATTGGGTTGGGAGCGAACATTGTGAATGAAAAGGTTAAAGAAGTGGACCAG
JMFN016N18+ ACTGAGAAAATTGGGTTGGGAGCGAACATTGTGAATGAAAAGGTTAAAGAAGTGGACCAG
                      ____________________________________________________________
consensus ACTGAGAAAATTGGGTTGGGAGCGAACATTGTGAATGAAAAGGTTAAAGAAGTGGACCAG
 
. : . : . : . : . : . :
JMSF037B21- AAGTTTCAGGTTTCCGAGAAGACAAAGTCTGCCATTGCTGCCGCGG
rJMSF037B21+ AAGTTTCAGGTTTCCGAGAAGACAAAGTCTGCCATTGCTGCCGCGGAGCAGACTGTTAGC
JMFN016N18+ AAGTTTCAGGTTTCCGAGAAGACAAAGTCTGCCATTGCTGCCGCGGAGCAGACTGTTAGC
                      ____________________________________________________________
consensus AAGTTTCAGGTTTCCGAGAAGACAAAGTCTGCCATTGCTGCCGCGGAGCAGACTGTTAGC
 
. : . : . : . : . : . :
rJMSF037B21+ AATGCTGGATCTGCCATTATGAAGAACAGGTACGTTCTCACCGGGGCAACTTGGGTCACT
JMFN016N18+ AATGCTGGATCTGCCATTATGAAGAACAGGTACGTTCTCACCGGGGCAACTTGGGTCACT
                      ____________________________________________________________
consensus AATGCTGGATCTGCCATTATGAAGAACAGGTACGTTCTCACCGGGGCAACTTGGGTCACT
 
. : . : . : . : . : . :
rJMSF037B21+ GGTGCCTTTAATAAGGTTACCAAGGCTGCTGGGGAAGTCGGGCAGAAGACAAAAGAAAAA
JMFN016N18+ GGTGCCTTTAATAAGGTTACCAAGGCTGCTGGGGAAGTCGGGCAGAAGACAAAAGAAAAA
                      ____________________________________________________________
consensus GGTGCCTTTAATAAGGTTACCAAGGCTGCTGGGGAAGTCGGGCAGAAGACAAAAGAAAAA
 
. : . : . : . : . : . :
rJMSF037B21+ TTGGCTGAAGAACAGCAGGTTAAAAATGCAACAGAAGGCTATACACAGTTACATGCTTCT
JMFN016N18+ TTGGCTGAAGAACAGCAGGTTAAAAATGCAACAGAAGGCTATACACAGTTACATGCTTCT
                      ____________________________________________________________
consensus TTGGCTGAAGAACAGCAGGTTAAAAATGCAACAGAAGGCTATACACAGTTACATGCTTCT
 
. : . : . : . : . : . :
rJMSF037B21+ GAATCCCCAAAGGCTTCCGCTGCTGAGGAACAAAACAAGTCCACTGTTCAGGGTTTAGTC
JMFN016N18+ GAATCCCCAAAGGCTTCCGCTGCTGAGGAACAAAACAAGTCCACTGTTCAGGGTTTAGTC
                      ____________________________________________________________
consensus GAATCCCCAAAGGCTTCCGCTGCTGAGGAACAAAACAAGTCCACTGTTCAGGGTTTAGTC
 
. : . : . : . : . : . :
rJMSF037B21+ CTTTAATTTGTGTAAATGTGTAAAACCCAGATATTTAAGTTTTAGAGGTTGCCTGCCATT
JMFN016N18+ CTTTAATTTGTGTAAATGTGTAAAACCCAGATATTTAAGTTTTAGAGGTTGCCTGCCATT
                      ____________________________________________________________
consensus CTTTAATTTGTGTAAATGTGTAAAACCCAGATATTTAAGTTTTAGAGGTTGCCTGCCATT
 
. : . : . : . : . : . :
rJMSF037B21+ TTCACTCATATGCTACTTAGAGACTTTGAAC
JMFN016N18+ TTCACTCATATGCTACTTAGAGACTTTGAACTGTAATTGTGCACTGTCAGAATTCAAACA
                      ____________________________________________________________
consensus TTCACTCATATGCTACTTAGAGACTTTGAACTGTAATTGTGCACTGTCAGAATTCAAACA
 
. : . : . : . : . : . :
JMFN016N18+ TGCTTTTTATACATCAAAACTTATTTAATXXXXXXXXXXXXXXXXXXXCTCGAGACTAGT
                      ____________________________________________________________
consensus TGCTTTTTATACATCAAAACTTATTTAATNNNNNNNNNNNNNNNNNNNCTCGAGACTAGT