Previous Contig 002476:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016K19Sequence545004367 (7)gb:AF030879_17625133e-39Solanum tuberosum protein kinase CPK1 mRNA, complete cds.792002476 (6)gb:AF030879_17625132e-68Solanum tuberosum protein kinase CPK1 mRNA, complete cds.
JMFF047J14Sequence619004367 (7)gb:AF030879_17625137e-21Solanum tuberosum protein kinase CPK1 mRNA, complete cds.593002476 (6)gb:AF435451_17998313e-40Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.
JMFN016K11Sequence533002476 (6)gb:AF435451_17998314e-14Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.
JMSF001P02Sequence331004367 (7)678002476 (6)gb:AF030879_17625133e-44Solanum tuberosum protein kinase CPK1 mRNA, complete cds.
JMSF016M18Sequence481004367 (7)gb:AF030879_17625130.037Solanum tuberosum protein kinase CPK1 mRNA, complete cds.780002476 (6)gb:AF435451_17998313e-74Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.
JMSF035F08Sequence734002476 (6)gb:AF435451_17998313e-70Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016M18+ AGCA
                      ____________________________________________________________
consensus AGCA
 
. : . : . : . : . : . :
rJMSF035F08+ GAGGAGTTGGCCGATCTCAAAGAT
rJMSF016M18+ GTTTGCTTTACGGCATTAGCAACCACACTAGACGATGAGGAGTTGGCTGATCTAAAAGAT
rJMFF016K19+ AAAGAT
                      ____________________________________________________________
consensus GTTTGCTTTACGGCATTAGCAACCACACTAGACGATGAGGAGTTGGCTGATCTCAAAGAT
 
. : . : . : . : . : . :
rJMSF035F08+ CAATTTGCTGCCATTGATGTGGATAAAAATGGTGTCATTAGTCTTGAAGAAATGAGACAG
rJMSF016M18+ CAATTTGCTGCCATTGATGTGGATAAAAATGGTGTCATTAGTCTTGAAGAAATGAGACAG
rJMFF016K19+ CAATTTGCTGCCATTGATGTGGATAAAAATGGTGTCATTAGTCTTGAAGAAATGAGACAG
                      ____________________________________________________________
consensus CAATTTGCTGCCATTGATGTGGATAAAAATGGTGTCATTAGTCTTGAAGAAATGAGACAG
 
. : . : . : . : . : . :
rJMSF035F08+ GCTCTTGCTAAGGATCTTCCATGGAAGATGAAAGAATCACGTGTTCTTGAGATTCTTCAA
rJMSF016M18+ GCTCTTGCTAAGGATCGTCCATGGAGAATGAAAGACTCACGCGTAATTGAGATTCTTCAA
rJMFF016K19+ GCTCTTGCTAAGGATCGTCCATGGAGAATGAAAGACTCACGCGTAATTGAGATTCTTCAA
                      ____________________________________________________________
consensus GCTCTTGCTAAGGATCGTCCATGGAGAATGAAAGACTCACGCGTAATTGAGATTCTTCAA
 
. : . : . : . : . : . :
rJMSF035F08+ GCGATTGACAGCAATACAGACGGACTTGTGGATTTCCAAGAGTTCGTTGCTGCCACGTTA
rJMSF016M18+ GCGATTGATGTCAATACTGATGGTCTCATAGATTTCCCCGAGTTTGTTGCTGCCACTTTA
rJMFF047J14+ GAGTTTGTTGCTGCCACTTTA
rJMFF016K19+ GCGATTGATGTCAATACTGATGGTCTCATAGATTTCCCCGAGTTTGTTGCTGCCACTTTA
rJMSF001P02+ GAGTTTGTTGCTGCCACTTTA
                      ____________________________________________________________
consensus GCGATTGATGTCAATACTGATGGTCTCATAGATTTCCCCGAGTTTGTTGCTGCCACTTTA
 
. : . : . : . : . : . :
rJMSF035F08+ CATGTCAACCAGATGGAGGAACATAATTCGGAAAATTGGCAACAAAGATCGCAAGCTGCT
rJMSF016M18+ CATGTTCATCAGATGGAGGAACACAACTCAGAAAAATGGCTGCAAAGATCACAAGCTGCT
rJMFF047J14+ CATGTTCATCAGATGGAGGAACACAACTCAGAAAAATGGCTGCAAAGATCACAAGCTGCT
rJMFF016K19+ CATGTTCATCAGATGGAGGAACACAACTCAGAAAAATGGCTGCAAAGATCACAAGCTGCT
rJMSF001P02+ CATGTTCATCAGATGGAGGAACACAACTCAGAAAAATGGCTGCAAAGATCACAAGCTGCT
                      ____________________________________________________________
consensus CATGTTCATCAGATGGAGGAACACAACTCAGAAAAATGGCTGCAAAGATCACAAGCTGCT
 
. : . : . : . : . : . :
rJMSF035F08+ TTTGAGAAATTTGACATCGACAAAGATGGATATATAACTCAAGAAGAACTTAAATTGCAT
rJMSF016M18+ TTTCAGAAATTCGATGTTGATAGAGATGGATTTATTACTCCCGAAGAACTTAAAATGCAT
rJMFF047J14+ TTTCAGAAATTCGATGTTGATAGAGATGGATTTATTACTCCCGAAGAACTTAAAATGCAT
rJMFF016K19+ TTTCAGAAATTCGATGTTGATAGAGATGGATTTATTACTCCCGAAGAACTTAAAATGCAT
rJMSF001P02+ TTTCAGAAATTCGATGTTGATAGAGANGGANTTATTACTCCCGAAGAACTTAAAATGCAT
                      ____________________________________________________________
consensus TTTCAGAAATTCGATGTTGATAGAGATGGATTTATTACTCCCGAAGAACTTAAAATGCAT
 
. : . : . : . : . : . :
rJMSF035F08+ ACCGGATTAAGAGGCTCCATAGACCCACTCCTAGAGGAAGCAGACATCGACAAAGATGGG
rJMSF016M18+ ACGGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
rJMFF047J14+ ACGGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
rJMFF016K19+ ACGGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
rJMSF001P02+ ACGGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
JMFN016K11- GGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
                      ____________________________________________________________
consensus ACGGGCTTAAAAGGTTCCATAGACCCACTTCTAGAGGAAGCAGACATCGACAAAGATGGG
 
. : . : . : . : . : . :
rJMSF035F08+ AAGATAAGCTTATCAGAGTTCCGCAAGCTTCTAAGAACAGCAAGCATGGGCTCACGGACA
rJMSF016M18+ AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
rJMFF047J14+ AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
rJMFF016K19+ AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
rJMSF001P02+ AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
JMFN016K11- AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
                      ____________________________________________________________
consensus AAGATAAGCTTATCAGAATTCCGCAGGCTTTTAAGAACTGCAAGTATGAGTTCACAGACA
 
. : . : . : . : . : . :
rJMSF035F08+ GTCTCTAGTCCATCTACAAGGCGAGGCTCAAGACTTTAAGG
rJMSF016M18+ ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
rJMFF047J14+ ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
rJMFF016K19+ ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
rJMSF001P02+ ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
JMFN016K11- ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
                      ____________________________________________________________
consensus ATTACTAGCCCCTCCGTGAAGGGAGGAGGTTCAC---GAGGACTTTCGAAGTGAAAGAGT
 
. : . : . : . : . : . :
rJMSF016M18+ TTTTATGGAGATATGCGTTAGAGCAGCAAAGTTTCCTTTCTCCTAGATTTCTGTCCTGGG
rJMFF047J14+ TTTTATGGAGATATGCGTTAGAGCAGCAAAGTTTCCTTTCTCCTAGATTTCTGTCCTGGG
rJMFF016K19+ TTTTATGGAGATATGCGTTAGAGCAGCAAAGTTTCCTTTCTCCTAGATTTCTGTCCTGGG
rJMSF001P02+ TTTTATGGAGATATGCGTTAGAGCAGCAAAGNTTCCTTTCTCCTAGATTTCTGTCCTGGG
JMFN016K11- TTTTATGGAGATATGCGTTAGAGCAGCAAAGTTTCCTTTCTCCTAGATTTCTGTCCTGGG
                      ____________________________________________________________
consensus TTTTATGGAGATATGCGTTAGAGCAGCAAAGTTTCCTTTCTCCTAGATTTCTGTCCTGGG
 
. : . : . : . : . : . :
rJMSF016M18+ GTCATCGTATACAGTTGCTTTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
rJMFF047J14+ GTCATCGTATACAGTTGCTTTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
rJMFF016K19+ GTCATCGTATACAGTTGCTTTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
rJMSF001P02+ GTCATCGTATACAGTTGCTNTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
JMFN016K11- GTCATCGTATACAGTTGCTTTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
                      ____________________________________________________________
consensus GTCATCGTATACAGTTGCTTTTTCTGCTTGTCTGCAAGTAGCCGAGGGATGCATCGCCCC
 
. : . : . : . : . : . :
rJMSF016M18+ CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGTAT
rJMFF047J14+ CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGTAT
rJMFF016K19+ CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGTAT
rJMSF001P02+ CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGNAT
JMFN016K11- CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGTAT
                      ____________________________________________________________
consensus CGACTTGCTTCTTCCCTCCACAAAAGCATTTTGTAATTCCTAATTTGGTCATTGTGGTAT
 
. : . : . : . : . : . :
rJMSF016M18+ AGTTATTTAGAGGGATGGCATTCCTAATTTGGTCATTGTGGTATAGCTATTTAGTGTTG
rJMFF047J14+ AGTTATTTAGAGGGATGGCATTCCTAATTTGGTCATTGTGGTATAGCTATTTAGTGTTGT
rJMFF016K19+ AGTTATTTAGAGGGATGGCATTCCTAATTTGGTCATTGTGGTATAGCTATTTAGTGTTGT
rJMSF001P02+ AGTTATTTAGAGGGATGGCATTCCTANTTTGGTCATTGTGGNATAGCTATTTAGTGTTGT
JMFN016K11- AGTTATTTAGAGGGATGGCATTCCTAATTTGGTCATTGTGGTATAGCTATTTAGTGTTGT
                      ____________________________________________________________
consensus AGTTATTTAGAGGGATGGCATTCCTAATTTGGTCATTGTGGTATAGCTATTTAGTGTTGT
 
. : . : . : . : . : . :
rJMFF047J14+ GAGTCTCCTTTGCAAA-GTGAAATATGCAATTGTGC
rJMFF016K19+ GAGTCTCCTTTGCAAA-GTGAAATATGCAATTGTGCAATGTATGTGTGTGGAAAAAATGC
rJMSF001P02+ GAGTCTCCTTTGCAAACGTGAAATATGCAANTGTGCAATGTATNTGTGTGGAAAAAATGC
JMFN016K11- GAGTCTCCTTTGCAAA-GTGAAATATGCAATTGTGCAATGTATGTGTGTGGAAAAAATGC
                      ____________________________________________________________
consensus GAGTCTCCTTTGCAAA-GTGAAATATGCAATTGTGCAATGTATGTGTGTGGAAAAAATGC
 
. : . : . : . : . : . :
rJMFF016K19+ TTAAAAA
rJMSF001P02+ TTAAAAACGTGTTGACTTAT
JMFN016K11- TTAAAAA-GTGTTGACTTATCAAGTGTTTGATGGATGTGGTTCAATAAAATTTAAGGATT
                      ____________________________________________________________
consensus TTAAAAACGTGTTGACTTATCAAGTGTTTGATGGATGTGGTTCAATAAAATTTAAGGATT