Previous Contig 002474:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051P11Sequence631005404 (5)gb:AY088045_15730691e-48Arabidopsis thaliana clone 40637 mRNA, complete sequence.594002474 (4)gb:AF281652_17829729e-17Atriplex hortensis putative DNA binding protein mRNA, complete cds.
JMFN016G13Sequence624002474 (4)gb:AF281652_17829729e-16Atriplex hortensis putative DNA binding protein mRNA, complete cds.
JMSF046L10Sequence759007949 (3)pir|T51151|T511511e-85probable nuclear DNA-binding protein G2p [imported] - Arabidopsis thaliana>gb:AT786002474 (4)gb:AF281652_17829722e-61Atriplex hortensis putative DNA binding protein mRNA, complete cds.
JMSF049N08Sequence606007949 (3)gb:AF281652_17829722e-59Atriplex hortensis putative DNA binding protein mRNA, complete cds.737002474 (4)gb:AF281652_17829723e-54Atriplex hortensis putative DNA binding protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046L10+ CTGGTGATGGCAAGCCAAAACTCTTGGATGAGAAACNAA
                      ____________________________________________________________
consensus CTGGTGATGGCAAGCCAAAACTCTTGGATGAGAAACNAA
 
. : . : . : . : . : . :
rJMSF049N08+ TATAAGAGAGCTGTGGATAAAAGCTACAATTTGAAGATGAAAGCATCTAGAT
rJMSF046L10+ CAACAATCTATAAGAGAGCTGTGGATAAAAGCTACAATTTGAAGATGAAAGCATCTAGAT
                      ____________________________________________________________
consensus CAACAATCTATAAGAGAGCTGTGGATAAAAGCTACAATTTGAAGATGAAAGCATCTAGAT
 
. : . : . : . : . : . :
rJMSF049N08+ TCATCTTTAGTGAGATCAGCCAGAAGTTCCCAATCATGCCATTTACGGCAAGGGATTTGG
rJMSF046L10+ TCATCTTTAGTGAGATCAGCCAGAAGTTCCCAATCATGCCATTTACGGCAAGGGATTTGG
                      ____________________________________________________________
consensus TCATCTTTAGTGAGATCAGCCAGAAGTTCCCAATCATGCCATTTACGGCAAGGGATTTGG
 
. : . : . : . : . : . :
rJMSF049N08+ AAGAGAAGAGGGCGCGTCTCGGACTGGTTGAATGTGTCAACCATGATCTTTTACAGCCAT
rJMSF046L10+ AAGAGAAGAGGGCGCGTCTCGGACTGGTTGAATGTGTCAACCATGATCTTTTACAGCCAT
                      ____________________________________________________________
consensus AAGAGAAGAGGGCGCGTCTCGGACTGGTTGAATGTGTCAACCATGATCTTTTACAGCCAT
 
. : . : . : . : . : . :
rJMSF049N08+ ATCCTGTTCTGCATGAAAAGCCTGGTGATTTGGTTGCTCACATAAAATTCACTGTTCTAT
rJMSF046L10+ ATCCTGTTCTGCATGAAAAGCCTGGTGATTTGGTTGCTCACATAAAATTCACTGTTCTAT
rJMFF051P11+ ATTTGGTTGCTCACATAAAATTCACTGTTCTAT
JMFN016G13- CTCACATAAAATTCACTGTTCTAT
                      ____________________________________________________________
consensus ATCCTGTTCTGCATGAAAAGCCTGGTGATTTGGTTGCTCACATAAAATTCACTGTTCTAT
 
. : . : . : . : . : . :
rJMSF049N08+ TGATGCCCAATGGATCTGATAGGGTTACATCGCATCCACTCCAGGAGCTTCAGGCTACTA
rJMSF046L10+ TGATGCCCAATGGATCTGATAGGGTTACATCGCATCCACTCCAGGAGCTTCAGGCTACTA
rJMFF051P11+ TGATGCCCAATGGATCTGATAGGGTTACATCGCATCCACTCCAGGAGCTTCAGGCTACTA
JMFN016G13- TGATGCCCAATGGATCTGATAGGGTTACATCGCATCCACTCCAGGAGCTTCAGGCTACTA
                      ____________________________________________________________
consensus TGATGCCCAATGGATCTGATAGGGTTACATCGCATCCACTCCAGGAGCTTCAGGCTACTA
 
. : . : . : . : . : . :
rJMSF049N08+ AGACAATAGACAATGAACCTGAGATTAAGGCTTGGCTAGCCCTTCCAACAAAGACAAAGA
rJMSF046L10+ AGACAATAGACAATGAACCTGAGATTAAGGCTTGGCTAGCCCTTCCAACAAAGACAAAGA
rJMFF051P11+ AGACAATAGACAATGAACCTGAGATTAAGGCTTGGCTAGCCCTTCCAACAAAGACAAAGA
JMFN016G13- AGACAATAGACAATGAACCTGAGATTAAGGCTTGGCTAGCCCTTCCAACAAAGACAAAGA
                      ____________________________________________________________
consensus AGACAATAGACAATGAACCTGAGATTAAGGCTTGGCTAGCCCTTCCAACAAAGACAAAGA
 
. : . : . : . : . : . :
rJMSF049N08+ AGAAAGGCGGGGGGAAGAAAAAGAAAGGCAAGAAAGGGGAGAAGGCTGAGGAGTCAAGCC
rJMSF046L10+ AGAAAGGCGGGGGGAAGAAAAAGAAAGGCAAGAAAGGGGAGAAGGCTGAGGAGTCAAGCC
rJMFF051P11+ AGAAAGGCGGGGGGAAGAAAAAGAAAGGCAAGAAAGGGGAGAAGGCTGAGGAGTCAAGCC
JMFN016G13- AGAAAGGCGGGGGGAAGAAAAAGAAAGGCAAGAAAGGGGAGAAGGCTGAGGAGTCAAGCC
                      ____________________________________________________________
consensus AGAAAGGCGGGGGGAAGAAAAAGAAAGGCAAGAAAGGGGAGAAGGCTGAGGAGTCAAGCC
 
. : . : . : . : . : . :
rJMSF049N08+ AGACTGAGGCAATGGAGGAAGATGCAAATGGTGCCAAGTCGTAGTGAACTTGTTCGTTTA
rJMSF046L10+ AGACTGAGGCAATGGAGGAAGATGCAAATGGTGCCAAGTCGTAGTGAACTTGTTCGTTTA
rJMFF051P11+ AGACTGAGGCAATGGAGGAAGATGCAAATGGTGCCAAGTCGTAGTGAACTTGTTCGTTTA
JMFN016G13- AGACTGAGGCAATGGAGGAAGATGCAAATGGTGCCAAGTCGTAGTGAACTTGTTCGTTTA
                      ____________________________________________________________
consensus AGACTGAGGCAATGGAGGAAGATGCAAATGGTGCCAAGTCGTAGTGAACTTGTTCGTTTA
 
. : . : . : . : . : . :
rJMSF049N08+ ATGTTGGTTTGGTAATCTCTTTGGAAGAGTGTGTTGAGGTTCCCTGATCAGCGATGCTTA
rJMSF046L10+ ATGTTGGTTTGGTAATCTCTTTGGAAGAGTGTGTTGAGGTTCCCTGATCAGCGATGCTTA
rJMFF051P11+ ATGTTGGTTTGGTAATCTCTTTGGAAGAGTGTGTTGAGGTTCCCTGATCAGCGATGCTTA
JMFN016G13- ATGTTGGTTTGGTAATCTCTTTGGAAGAGTGTGTTGAGGTTCCCTGATCAGCGATGCTTA
                      ____________________________________________________________
consensus ATGTTGGTTTGGTAATCTCTTTGGAAGAGTGTGTTGAGGTTCCCTGATCAGCGATGCTTA
 
. : . : . : . : . : . :
rJMSF049N08+ AACGATGAGCTGATTGTGCTTCCTTTGCATATGTGGGATGGATGCTTGTCATCGTTACAA
rJMSF046L10+ AACGATGAGCTGATTGTGCTTCCTTTGCATATGTGGGATGGATGCTTGTCATCGTTACAA
rJMFF051P11+ AACGATGAGCTGATTGTGCTTCCTTTGCATATGTGGGATGGATGCTTGTCATCGTTACAA
JMFN016G13- AACGATGAGCTGATTGTGCTTCCTTTGCATATGTGGGATGGATGCTTGTCATCGTTACAA
                      ____________________________________________________________
consensus AACGATGAGCTGATTGTGCTTCCTTTGCATATGTGGGATGGATGCTTGTCATCGTTACAA
 
. : . : . : . : . : . :
rJMSF049N08+ ATACACTTTGGAACGTTTCATTGTTCTGTGGTTTAACTGC-ATGCTTTTAAG
rJMSF046L10+ ATACACTTTGGAACGTTTCATTGTTCTGTGGTTTAACTGCAATGCTTTTAAG
rJMFF051P11+ ATACACTTTGGAACGTTTCATTGTTCTGTGGTTTAACTGCAATGCTTTTAAG
JMFN016G13- ATACACTTTGGAACGTTTCATTGTTCTGTGGTTTAACTGCAATGCTTTTAAGACCTTAGC
                      ____________________________________________________________
consensus ATACACTTTGGAACGTTTCATTGTTCTGTGGTTTAACTGCAATGCTTTTAAGACCTTAGC
 
. : . : . : . : . : . :
JMFN016G13- TCGCGGGGAACAGTAAAAGAAAGAGCAGTATGGAGAAGATAAAGAACAGTGAGAAGAACA
                      ____________________________________________________________
consensus TCGCGGGGAACAGTAAAAGAAAGAGCAGTATGGAGAAGATAAAGAACAGTGAGAAGAACA
 
. : . : . : . : . : . :
JMFN016G13- ATTTTATTGTCTTGTAATCTCTAACTTCTGTACATGAATACAATAATATATAGAGTACAA
                      ____________________________________________________________
consensus ATTTTATTGTCTTGTAATCTCTAACTTCTGTACATGAATACAATAATATATAGAGTACAA
 
. : . : . : . : . : . :
JMFN016G13- ATGTAACCTTCTCATTAAGTACAAAAACTGTTTCAGCTGTTACAAATAATCATAATAATG
                      ____________________________________________________________
consensus ATGTAACCTTCTCATTAAGTACAAAAACTGTTTCAGCTGTTACAAATAATCATAATAATG