Previous Contig 002472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016F14Sequence527002472 (2)pir|T48875|T488758e-31copper transport protein [imported] - Arabidopsis thaliana>gb:ATCTRPPRO_1548028
JMFN045O05Sequence477002472 (2)pir|T48875|T488758e-31copper transport protein [imported] - Arabidopsis thaliana>gb:ATCTRPPRO_1548028

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN045O05+ AAGAATACAGAAAATATGTATTAC
JMFN016F14+ ATTAAAATTNTGAAACTTTAATTAAGAATACAGAAAATATGTATTAC
                      ____________________________________________________________
consensus ATTAAAATTNTGAAACTTTAATTAAGAATACAGAAAATATGTATTAC
 
. : . : . : . : . : . :
JMFN045O05+ TTGATTCATCAATCATCGATGAACAGTTACAACTCATTAGGAGAAAGATCAGATCTCTTC
JMFN016F14+ TTGATTCATCAATCATCGATGAACAGTTACAACTCATTAGGAGAAAGATCAGATCTCTTC
                      ____________________________________________________________
consensus TTGATTCATCAATCATCGATGAACAGTTACAACTCATTAGGAGAAAGATCAGATCTCTTC
 
. : . : . : . : . : . :
JMFN045O05+ ACATAAGCTGTTAGCGGCGATTTCTTGAAAGCCACGCTGCCGAAGAAGAAGAATCCGAGG
JMFN016F14+ ACATAAGCTGTTAGCGGCGATTTCTTGAAAGCCACGCTGCCGAAGAAGAAGAATCCGAGG
                      ____________________________________________________________
consensus ACATAAGCTGTTAGCGGCGATTTCTTGAAAGCCACGCTGCCGAAGAAGAAGAATCCGAGG
 
. : . : . : . : . : . :
JMFN045O05+ GTGTGGCCGGCCATGGCCGCCAGGAACACGCCGCCGTTGAACGACATCACGGCCAGCATC
JMFN016F14+ GTGTGGCCGGCCATGGCCGCCAGGAACACGCCGCCGTTGAACGACATCACGGCCAGCATC
                      ____________________________________________________________
consensus GTGTGGCCGGCCATGGCCGCCAGGAACACGCCGCCGTTGAACGACATCACGGCCAGCATC
 
. : . : . : . : . : . :
JMFN045O05+ ACTATGTACGCCAGCCCGATTCTCAACCCGTACACCGCCGTCTCCAGCAGCCCCGCTGCC
JMFN016F14+ ACTATGTACGCCAGCCCGATTCTCAACCCGTACACCGCCGTCTCCAGCAGCCCCGCTGCC
                      ____________________________________________________________
consensus ACTATGTACGCCAGCCCGATTCTCAACCCGTACACCGCCGTCTCCAGCAGCCCCGCTGCC
 
. : . : . : . : . : . :
JMFN045O05+ ACCTGGCTCTCGGAATCATCCACGCCGTCGCGATTCGACACCCACTCCAGTAGAAAAGCC
JMFN016F14+ ACCTGGCTCTCGGAATCATCCACGCCGTCGCGATTCGACACCCACTCCAGTAGAAAAGCC
                      ____________________________________________________________
consensus ACCTGGCTCTCGGAATCATCCACGCCGTCGCGATTCGACACCCACTCCAGTAGAAAAGCC
 
. : . : . : . : . : . :
JMFN045O05+ AGAGCAAAAACGACCAGCAGCGACAGGATATACATCCCGAAGTGGTCGTATCCCGGCCAG
JMFN016F14+ AGAGCAAAAACGACCAGCAGCGACAGGATATACATCCCGAAGTGGTCGTATCCCGGCCAG
                      ____________________________________________________________
consensus AGAGCAAAAACGACCAGCAGCGACAGGATATACATCCCGAAGTGGTCGTATCCCGGCCAG
 
. : . : . : . : . : . :
JMFN045O05+ CCGGAGAAGAGGACCTCGGCGTTCTTGCCCCAGAAGAACGTCATGTGCATCATGTGGCCG
JMFN016F14+ CCGGAGAAGAGGACCTCGGCGTTCTTGCCCCAGAAGAACGTCATGTGCATCATGTGGCCG
                      ____________________________________________________________
consensus CCGGAGAAGAGGACCTCGGCGTTCTTGCCCCAGAAGAACGTCATGTGCATCATGTGGCCG
 
. : . : . : . : . : . :
JMFN045O05+ TGGCCGGCGGTGGAGTTCATTCCGGGCATTTCC
JMFN016F14+ TGGCCGGCGGTGGAGTTCATTCCGGGCATTTCCATGGCTGTCTCTCTCTCTTGGGTTTTT
                      ____________________________________________________________
consensus TGGCCGGCGGTGGAGTTCATTCCGGGCATTTCCATGGCTGTCTCTCTCTCTTGGGTTTTT