Previous Contig 002468:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G23Sequence451000944 (2)gb:AB125311_15281547e-15Oryza sativa (japonica cultivar-group) SAPK10 mRNA for serine/threonine protein 728002468 (4)gb:ATH316009_15524892e-68Arabidopsis thaliana ost1 gene for protein kinase, exons 1-10.>gb:AY054624_15632
JMFF039E05Sequence433000944 (2)gb:AB125311_15281541e-13Oryza sativa (japonica cultivar-group) SAPK10 mRNA for serine/threonine protein 615002468 (4)gb:ATH316009_15524893e-38Arabidopsis thaliana ost1 gene for protein kinase, exons 1-10.>gb:AY054624_15632
JMFN013A12Sequence625002468 (4)gb:ATH316009_1552489e-108Arabidopsis thaliana ost1 gene for protein kinase, exons 1-10.>gb:AY054624_15632
JMFN016C10Sequence533002468 (4)gb:ATH316009_15524891e-18Arabidopsis thaliana ost1 gene for protein kinase, exons 1-10.>gb:AY054624_15632

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013A12- GAAAATGTGCAGAGAGAAATTATAAACCACAGATCATTAAGGCATCCCAACATTGT
                      ____________________________________________________________
consensus GAAAATGTGCAGAGAGAAATTATAAACCACAGATCATTAAGGCATCCCAACATTGT
 
. : . : . : . : . : . :
JMFN013A12- CAGATTTAAGGAAGTCATATTGACACCGACTCATTTGGCTATTGTAATGGAATATGCATC
                      ____________________________________________________________
consensus CAGATTTAAGGAAGTCATATTGACACCGACTCATTTGGCTATTGTAATGGAATATGCATC
 
. : . : . : . : . : . :
JMFN013A12- TGGTGGAGAGCTGTTTGAGCGGATTTGCAATGCTGGTCGATTCAGCGAGGATGAGGCACG
                      ____________________________________________________________
consensus TGGTGGAGAGCTGTTTGAGCGGATTTGCAATGCTGGTCGATTCAGCGAGGATGAGGCACG
 
. : . : . : . : . : . :
JMFN013A12- GTTTTTCTTTCAGCAACTAATATCAGGGGTCAGCTATTGTCATTCAATGCAAGTATGCCA
                      ____________________________________________________________
consensus GTTTTTCTTTCAGCAACTAATATCAGGGGTCAGCTATTGTCATTCAATGCAAGTATGCCA
 
. : . : . : . : . : . :
JMFN013A12- CCGAGACTTGAAATTGGAAAACACATTACTGGATGGGAGCCCAGCACCACGTCTAAAGAT
                      ____________________________________________________________
consensus CCGAGACTTGAAATTGGAAAACACATTACTGGATGGGAGCCCAGCACCACGTCTAAAGAT
 
. : . : . : . : . : . :
JMFN013A12- ATGTGATTTTGGATATTCAAAGTCTTCGGTGCTGCATTCACAACCGAAGTCAACTGTTGG
                      ____________________________________________________________
consensus ATGTGATTTTGGATATTCAAAGTCTTCGGTGCTGCATTCACAACCGAAGTCAACTGTTGG
 
. : . : . : . : . : . :
JMFN013A12- AACTCCTGCATACATTGCACCTGAAGTGTTGCTGAAGAAAGAATATGATGGCAAGATTGC
rJMFF018G23+ GAAGAAAGAATATGATGGCAAGATTGC
                      ____________________________________________________________
consensus AACTCCTGCATACATTGCACCTGAAGTGTTGCTGAAGAAAGAATATGATGGCAAGATTGC
 
. : . : . : . : . : . :
JMFN013A12- AGATGTGTGGTCTTGTGGGGTCACCTTGTACGTAATGCTAGTTGGTGCTTACCCTTTTGA
rJMFF018G23+ AGATGTGTGGTCTTGTGGGGTCACCTTGTACGTAATGCTAGTTGGTGCTTACCCTTTTGA
                      ____________________________________________________________
consensus AGATGTGTGGTCTTGTGGGGTCACCTTGTACGTAATGCTAGTTGGTGCTTACCCTTTTGA
 
. : . : . : . : . : . :
JMFN013A12- GCACCCTGATGAGCCGAAAAACTTCAGGAAGACAATACAGCCCTTTTGGTGCAGCGAATC
rJMFF018G23+ GCACCCTGATGAGCCGAAAAACTTCAGGAAGACAATA--------------CAGCGAATC
                      ____________________________________________________________
consensus GCACCCTGATGAGCCGAAAAACTTCAGGAAGACAATACAGCCCTTTTGGTGCAGCGAATC
 
. : . : . : . : . : . :
JMFN013A12- TTGAATGTTCAGTACTCAATACCA-GATTATGTTCACATCTCCCCAGAATGCCGTCATCT
rJMFF018G23+ TTGAATGTTCAGTACTCAATACCA-GATTATGTTCACATCTCCCCAGAATGCCGTCATCT
rJMFF039E05+ TGTTCAGTACTCAATACCAGGATTATGTTCACATCTCCCCAGAATGCCGTCATCT
                      ____________________________________________________________
consensus TTGAATGTTCAGTACTCAATACCA-GATTATGTTCACATCTCCCCAGAATGCCGTCATCT
 
. : . : . : . : . : . :
JMFN013A12- GATCTCAAGGATCTTTGTAGCTGATCCTAC
rJMFF018G23+ GATCTCAAGGATCTTTGTAGCTGATCCTACACAGAGGATATCCATTCCTGAAATCAAGAA
rJMFF039E05+ GATCTCAAGGATCTTTGTAGCTGATCCTACACAGAGGATATCCATTCCTGAAATCAAGAA
                      ____________________________________________________________
consensus GATCTCAAGGATCTTTGTAGCTGATCCTACACAGAGGATATCCATTCCTGAAATCAAGAA
 
. : . : . : . : . : . :
rJMFF018G23+ TCACGAGTGGTTCCTGAAGAACCTCCCTGCGGACCTCATGGATGACAATACAACCAATAA
rJMFF039E05+ TCACGAGTGGTTCCTGAAGAACCTCCCTGCGGACCTCATGGATGACAATACAACCAATAA
JMFN016C10- TGGTTCCTGAAGAACCTCCCTGCGGACCTCATGGATGACAATACAACCAATAA
                      ____________________________________________________________
consensus TCACGAGTGGTTCCTGAAGAACCTCCCTGCGGACCTCATGGATGACAATACAACCAATAA
 
. : . : . : . : . : . :
rJMFF018G23+ CCAGTTCGAGGAGCCAGATCAACCGATGCAGAGCATTGATGAAATCATGCAGATAATAGC
rJMFF039E05+ CCAGTTCGAGGAGCCAGATCAACCGATGCAGAGCATTGATGAAATCATGCAGATAATAGC
JMFN016C10- CCAGTTCGAGGAGCCAGATCAACCGATGCAGAGCATTGATGAAATCATGCAGATAATAGC
                      ____________________________________________________________
consensus CCAGTTCGAGGAGCCAGATCAACCGATGCAGAGCATTGATGAAATCATGCAGATAATAGC
 
. : . : . : . : . : . :
rJMFF018G23+ GGAGGCCACCATTCCAGCTGCCGGGACTAACAGCCTCAACAATTATCTTACCGGAAGCTT
rJMFF039E05+ GGAGGCCACCATTCCAGCTGCCGGGACTAACAGCCTCAACAATTATCTTACCGGAAGCTT
JMFN016C10- GGAGGCCACCATTCCAGCTGCCGGGACTAACAGCCTCAACAATTATCTTACCGGAAGCTT
                      ____________________________________________________________
consensus GGAGGCCACCATTCCAGCTGCCGGGACTAACAGCCTCAACAATTATCTTACCGGAAGCTT
 
. : . : . : . : . : . :
rJMFF018G23+ AGACATCGACGATGACATGGAAGAAGACTTGGAGAGCGACCCTGACCTCGACATTGAGAG
rJMFF039E05+ AGACATCGACGATGACATGGAAGAAGACTTGGAGAGCGACCCTGACCTCGACATTGAGAG
JMFN016C10- AGACATCGACGATGACATGGAAGAAGACTTGGAGAGCGACCCTGACCTCGACATTGAGAG
                      ____________________________________________________________
consensus AGACATCGACGATGACATGGAAGAAGACTTGGAGAGCGACCCTGACCTCGACATTGAGAG
 
. : . : . : . : . : . :
rJMFF018G23+ CAGTGGAGAGATAGTATACGCAATGTGAGATGTGCACAGGACAGCTGGGTGAACACAACA
rJMFF039E05+ CAGTGGAGAGATAGTATACGCAATGTGAGATGTGCACAGGACAGCTGGGTGAACACAACA
JMFN016C10- CAGTGGAGAGATAGTATACGCAATGTGAGATGTGCACAGGACAGCTGGGTGAACACAACA
                      ____________________________________________________________
consensus CAGTGGAGAGATAGTATACGCAATGTGAGATGTGCACAGGACAGCTGGGTGAACACAACA
 
. : . : . : . : . : . :
rJMFF018G23+ TACAATACCCGCACTGCTCTATACTTTGAATCTATTGCCAGTCTCTCTTTGGTGTGAATA
rJMFF039E05+ TACAATACCCGCACTGCTCTATACTTTGAATCTATTGCCAGTCTCTCTTTGGTGTGAATA
JMFN016C10- TACAATACCCGCACTGCTCTATACTTTGAATCTATTGCCAGTCTCTCTTTGGTGTGAATA
                      ____________________________________________________________
consensus TACAATACCCGCACTGCTCTATACTTTGAATCTATTGCCAGTCTCTCTTTGGTGTGAATA
 
. : . : . : . : . : . :
rJMFF018G23+ TTACAGGACAGACTCATCCCCCACCCCATGGCCTTTTCAACTGCTTGTTTTCTTTCATGC
rJMFF039E05+ TTACAGGACAGACTCATCCCCCACCCCATGGCCTTTTCAACTGCTTGTTTTCTTTCATGC
JMFN016C10- TTACAGGACAGACTCATCCCCCACCCCATGGCCTTTTCAACTGCTTGTTTTCTTTCATGC
                      ____________________________________________________________
consensus TTACAGGACAGACTCATCCCCCACCCCATGGCCTTTTCAACTGCTTGTTTTCTTTCATGC
 
. : . : . : . : . : . :
rJMFF018G23+ TTTTGTTCTCGTGTAATGTTCATTTTCTCTCTGTGGCATCTTATATAAAACATCAC
rJMFF039E05+ TTTTGTTCTCGTGTAATGTTCATTTTCTCTCTGTGGCATCTTATATAAAACATCACTGTA
JMFN016C10- TTTTGTTCTCGTGTAATGTTCATTTTCTCTCTGTGGCATCTTATATAAAACATCACTGTA
                      ____________________________________________________________
consensus TTTTGTTCTCGTGTAATGTTCATTTTCTCTCTGTGGCATCTTATATAAAACATCACTGTA
 
. : . : . : . : . : . :
rJMFF039E05+ CTGCTTTCATAATCCATACT
JMFN016C10- CTGCTTTCATAATCCATACTTGACTTTCTCTTTTGTAATTGTACAACAAACTCCATTTCC
                      ____________________________________________________________
consensus CTGCTTTCATAATCCATACTTGACTTTCTCTTTTGTAATTGTACAACAAACTCCATTTCC