Previous Contig 002467:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016C09Sequence625002467 (3)gb:NPL428214_16910865e-22Nicotiana plumbaginifolia mRNA for SDL-1 protein (sdl-1 gene).
JMFS043C12Sequence474002467 (3)gb:NPL428214_16910862e-22Nicotiana plumbaginifolia mRNA for SDL-1 protein (sdl-1 gene).
JMSF034A14Sequence690004215 (3)gb:ATY15066_15575200.017Arabidopsis thaliana mRNA for ethylene-regulated transcript 2.516002467 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034A14- CCCGACN
                      ____________________________________________________________
consensus CCCGACN
 
. : . : . : . : . : . :
rJMSF034A14- TTTAATTTGGACNATTTAACCACTGGACTATCAGAATCTTTTCAATTGTGGTCCTTCCGT
                      ____________________________________________________________
consensus TTTAATTTGGACNATTTAACCACTGGACTATCAGAATCTTTTCAATTGTGGTCCTTCCGT
 
. : . : . : . : . : . :
rJMSF034A14- CAAATCCAAGTTAAGTGGACGTCAATTTAAAGGGTAAAAGCGTCATTTCCATCTTCCCTC
                      ____________________________________________________________
consensus CAAATCCAAGTTAAGTGGACGTCAATTTAAAGGGTAAAAGCGTCATTTCCATCTTCCCTC
 
. : . : . : . : . : . :
rJMSF034A14- CCTCTTCTGTCTTCTCTTCGTTGACAATGCAACAGAGCAGACCACGTGGACTGCGTGGTT
JMFN016C09+ GACAGTGCAACAGAGCATGCCACGTGGACTGTGTGGCT
                      ____________________________________________________________
consensus CCTCTTCTGTCTTCTCTTCGTTGACAGTGCAACAGAGCATGCCACGTGGACTGTGTGGTT
 
. : . : . : . : . : . :
rJMSF034A14- GGGCGGTAATGACGGCAGATGGTGGTGGTCGTCGGTAATGGTTGCTGTCCGGCATAACGG
JMFN016C09+ GGACGGTATTGACGGCAGATGGTGGTGGTCGTCGGTAATGGATGCTGTCCGGCGTAACGG
                      ____________________________________________________________
consensus GGGCGGTATTGACGGCAGATGGTGGTGGTCGTCGGTAATGGTTGCTGTCCGGCGTAACGG
 
. : . : . : . : . : . :
rJMSF034A14- CGCGGTGGTGGAACCCTCTCTCTCGCTCGTCGACGGCAAAGGTAGT----------TACA
JMFN016C09+ CGCGATGGTGGAGCCCTCTCTCTCGCTCGTCAACAGCAATGGTAGTAGCTTTACTCTCCA
                      ____________________________________________________________
consensus CGCGGTGGTGGAGCCCTCTCTCTCGCTCGTCGACGGCAATGGTAGTAGCTTTACTCTCCA
 
. : . : . : . : . : . :
rJMSF034A14- GTAGCGGACTCCCGACGGCAAAGCAGGATAAATCCAAAGAAAGATTCAGCAACACCATCA
JMFN016C09+ GTAGCGGACTCCCGACGGCAAAGCATGATAAATCCAAAGAAAGATTCAGCAACTCCATCA
                      ____________________________________________________________
consensus GTAGCGGACTCCCGACGGCAAAGCATGATAAATCCAAAGAAAGATTCAGCAACTCCATCA
 
. : . : . : . : . : . :
rJMSF034A14- TAGCACAAATTATATT
JMFN016C09+ TATCACAAATTATATTCTTTGACTTGAGATCTGATTCAGAATTGGGTCTAGTCCCTGTAG
                      ____________________________________________________________
consensus TATCACAAATTATATTCTTTGACTTGAGATCTGATTCAGAATTGGGTCTAGTCCCTGTAG
 
. : . : . : . : . : . :
JMFS043C12+ TGGCCCACG
JMFN016C09+ TAAGAAAAAGTCGCTGAATTCCGACGGAAAAGCAGGGAACAATCCGAGGACTGGCCCACG
                      ____________________________________________________________
consensus TAAGAAAAAGTCGCTGAATTCCGACGGAAAAGCAGGGAACAATCCGAGGACTGGCCCACG
 
. : . : . : . : . : . :
JMFS043C12+ GTGGCCAGAGGCGAGCTATCCATTCTCAGAAACTTGCGCGACTCCTCGGGGGACCACCGT
JMFN016C09+ GTGGCCAGAGGCGAGCTATCCATTCTCAGAAACTTGCGCGACTCCTCGGGGGACCACCGT
                      ____________________________________________________________
consensus GTGGCCAGAGGCGAGCTATCCATTCTCAGAAACTTGCGCGACTCCTCGGGGGACCACCGT
 
. : . : . : . : . : . :
JMFS043C12+ GATATTGGATCGTCGACTCCCCCGCTGTGCCATTGGAGGACGAAGGCGAAGAGCGCAAGG
JMFN016C09+ GATATTGGATCGTCGACTCCCCCGCTGTGCCATTGGAGGACGAAGGCGAAGAGCGCAAGG
                      ____________________________________________________________
consensus GATATTGGATCGTCGACTCCCCCGCTGTGCCATTGGAGGACGAAGGCGAAGAGCGCAAGG
 
. : . : . : . : . : . :
JMFS043C12+ GAGATGGGCTGCAGAGTGAGAGGAGAACTAGATTAGTGGCGAAGGAGGCGGCGGCGAATG
JMFN016C09+ GAGATGGGCTGCAGAGTGAGAGGAGAACTAGATTAGTGGCGAAGGAGGCGGCGGCGAATG
                      ____________________________________________________________
consensus GAGATGGGCTGCAGAGTGAGAGGAGAACTAGATTAGTGGCGAAGGAGGCGGCGGCGAATG
 
. : . : . : . : . : . :
JMFS043C12+ CGGAAGACGGTGGTTGGGGCCGGAGAGAAGCACTGAGACCCGCCATG
JMFN016C09+ CGGAAGACGGTGGTTGGGGCCGGAGAGAAGCACTGAGACCCGCCATGGTAGATGGGGAAA
                      ____________________________________________________________
consensus CGGAAGACGGTGGTTGGGGCCGGAGAGAAGCACTGAGACCCGCCATGGTAGATGGGGAAA