Previous Contig 002440:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014G02Sequence618002440 (3)gb:AY519524_16109512e-22Arabidopsis thaliana MYB transcription factor (At1g19510) mRNA, complete cds.>gb
JMFN016B12Sequence468002440 (3)gb:AC007858_15362713e-17Oryza sativa (japonica cultivar-group) chromosome 5 clone BAC 10A19I, complete s
JMFN018N10Sequence554002440 (3)gb:AY519524_16109511e-22Arabidopsis thaliana MYB transcription factor (At1g19510) mRNA, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016B12+ AATAGATTAAGGATTATATACGTA
JMFN014G02+ TTAAGGATTATATACGTA
                      ____________________________________________________________
consensus AATAGATTAAGGATTATATACGTA
 
. : . : . : . : . : . :
JMFN016B12+ CATACATTGCCATAAACGNCGATATACATATATAGATATGGAAGAAACATATATATTATA
JMFN018N10+ ATAGATATGGAAGAAACATATATATTATA
JMFN014G02+ CATACATTGCCATAAACGNCGATATACATATATAGATATGGAAGAAACATATATATTATA
                      ____________________________________________________________
consensus CATACATTGCCATAAACGNCGATATACATATATAGATATGGAAGAAACATATATATTATA
 
. : . : . : . : . : . :
JMFN016B12+ TTACAACATAAAGTGGTGAATAATTAGTACTGAAAATTAAAGGATCGGACTACCGCAGAA
JMFN018N10+ TTNCAACATAAAGTGGTGAATAATTAGTACTGAAAATTAAAGGATCGGACTACCGCAGAA
JMFN014G02+ TTNCAACATAAAGTGGTGAATAATTAGTACTGAAAATTAAAGGATCGGACTACCGCAGAA
                      ____________________________________________________________
consensus TTACAACATAAAGTGGTGAATAATTAGTACTGAAAATTAAAGGATCGGACTACCGCAGAA
 
. : . : . : . : . : . :
JMFN016B12+ GACATGACAGCAGATTAGATTATTTTGAGATCGGATGAAATCTACGGTGATGACAGATCC
JMFN018N10+ GACATGACAGCAGATTAGATTATTTTGAGATCGGATGAAATCTACGGTGATGACAGATCC
JMFN014G02+ GACATGACAGCAGATTAGATTATTTTGAGATCGGATGAAATCTACGGTGATGACAGATCC
                      ____________________________________________________________
consensus GACATGACAGCAGATTAGATTATTTTGAGATCGGATGAAATCTACGGTGATGACAGATCC
 
. : . : . : . : . : . :
JMFN016B12+ ATATCGAACCCCATCGTCATCTTATTAATCTTCTAATCAGACCTCTTCTTATTGCAGCTT
JMFN018N10+ ATATCGAACCCCATCGTCATCTTATTAATCTTCTAATCAGACCTCTTCTTATTGCAGCTT
JMFN014G02+ ATATCGAACCCCATCGTCATCTTATTAATCTTCTAATCAGACCTCTTCTTATTGCAGCTT
                      ____________________________________________________________
consensus ATATCGAACCCCATCGTCATCTTATTAATCTTCTAATCAGACCTCTTCTTATTGCAGCTT
 
. : . : . : . : . : . :
JMFN016B12+ AAGAAACCTCAGAAGCCTTTGCTCATCAACGGCGGTGGTCTTGTAGGCCGGGAGAGGAAC
JMFN018N10+ AAGAAACCTCAGAAGCCTTTGCTCATCAACGGCGGTGGTCTTGTAGGCCGGGAGAGGAAC
JMFN014G02+ AAGAAACCTCAGAAGCCTTTGCTCATCAACGGCGGTGGTCTTGTAGGCCGGGAGAGGAAC
                      ____________________________________________________________
consensus AAGAAACCTCAGAAGCCTTTGCTCATCAACGGCGGTGGTCTTGTAGGCCGGGAGAGGAAC
 
. : . : . : . : . : . :
JMFN016B12+ GTCGCCGCACTCTATACGGCGCAGATCCTCCAGAAGGATCTCATAGTGGCGCTTGACGTC
JMFN018N10+ GTCGCCGCACTCTATACGGCGCAGATCCTCCAGAAGGATCTCATAGTGGCGCTTGACGTC
JMFN014G02+ GTCGCCGCACTCTATACGGCGCAGATCCTCCAGAAGGATCTCATAGTGGCGCTTGACGTC
                      ____________________________________________________________
consensus GTCGCCGCACTCTATACGGCGCAGATCCTCCAGAAGGATCTCATAGTGGCGCTTGACGTC
 
. : . : . : . : . : . :
JMFN016B12+ GTCGGCGGACTTGCCGCCACCCACAGCTCTGGCGACATTCTGCCACCGGTCCGGCGTGTC
JMFN018N10+ GTCGGCGGACTTGCCGCCACCCACAGCTCTGGCGACATTCTGCCACCGGTCCGGCGTGTC
JMFN014G02+ GTCGGCGGACTTGCCGCCACCCACAGCTCTGGCGACATTCTGCCACCGGTCCGGCGTGTC
                      ____________________________________________________________
consensus GTCGGCGGACTTGCCGCCACCCACAGCTCTGGCGACATTCTGCCACCGGTCCGGCGTGTC
 
. : . : . : . : . : . :
JMFN016B12+ CTTGTCAAACGTCGCCAAAGCCTT
JMFN018N10+ CTTGTCAAACGTCGCCAAAGCCTTCTCAAACAACTTGTTTTGGCGGGGAGTCCATGAAGA
JMFN014G02+ CTTGTCAAACGTCGCCAAAGCCTTCTCAAACAACTTGTTTTGGCGGGGAGTCCATGAAGA
                      ____________________________________________________________
consensus CTTGTCAAACGTCGCCAAAGCCTTCTCAAACAACTTGTTTTGGCGGGGAGTCCATGAAGA
 
. : . : . : . : . : . :
JMFN018N10+ ACGAAAGGAACTTGATGCCATTGCAACTTCTTATTATTTATTTTAAAAGGGAAAAAAAAA
JMFN014G02+ ACGAAAGGAACTTGATGCCATTGCAACTTCTTATTATTTATTTTAAAAGGGAAAAAAAAA
                      ____________________________________________________________
consensus ACGAAAGGAACTTGATGCCATTGCAACTTCTTATTATTTATTTTAAAAGGGAAAAAAAAA
 
. : . : . : . : . : . :
JMFN018N10+ AAACCAAAAAAGAAAGAAGAGAATTGAAAAGAGTGGAGCAGATAA
JMFN014G02+ AAACCAAAAAAGAAAGAAGAGAATTGAAAAGAGTGGAGCAGATAAGGAAAGAGAGATTGA
                      ____________________________________________________________
consensus AAACCAAAAAAGAAAGAAGAGAATTGAAAAGAGTGGAGCAGATAAGGAAAGAGAGATTGA