Previous Contig 002437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014C15Sequence627002437 (2)pir|T48071|T480711e-35hypothetical protein F26K9.250 - Arabidopsis thaliana>gb:ATF26K9_1550129 Arabido
JMFN020F17Sequence620002437 (2)pir|T48071|T480712e-28hypothetical protein F26K9.250 - Arabidopsis thaliana>gb:ATF26K9_1550129 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020F17+ ATGATAACCAGTCTAGTAAATCAATGCCAGCNTATCGTACAA
                      ____________________________________________________________
consensus ATGATAACCAGTCTAGTAAATCAATGCCAGCNTATCGTACAA
 
. : . : . : . : . : . :
JMFN020F17+ AGAGAAACTAAATAGTATAAGAAAGTAAATAGGAGTGGGCAGTGCAACTGCAAGTCAATG
JMFN014C15+ TGCAAGTCAATG
                      ____________________________________________________________
consensus AGAGAAACTAAATAGTATAAGAAAGTAAATAGGAGTGGGCAGTGCAACTGCAAGTCAATG
 
. : . : . : . : . : . :
JMFN020F17+ G-GTAGGCATT-AGGGCCAGTTGTAGCTAGTTTGTTAACCAAAGCCAGGGCATTACTAGT
JMFN014C15+ GTGTAGGCATTGAGGGCCAGTTGTAGCTAGTTTGTTAACCAAAGCCAGGGCATTACTAGT
                      ____________________________________________________________
consensus GTGTAGGCATTGAGGGCCAGTTGTAGCTAGTTTGTTAACCAAAGCCAGGGCATTACTAGT
 
. : . : . : . : . : . :
JMFN020F17+ CAAGTAACTCACATTTGTGACTTTGTTTACCAACCATCTAACCTTCTTTCTCTTTGGCCT
JMFN014C15+ CAAGTAACTCACATTTGTGACTTTGTTTACCAACCATCTAACCTTCTTTCTCTTTGGCCT
                      ____________________________________________________________
consensus CAAGTAACTCACATTTGTGACTTTGTTTACCAACCATCTAACCTTCTTTCTCTTTGGCCT
 
. : . : . : . : . : . :
JMFN020F17+ ACCAAAACCATCCAAGCAAGTATCCTCATTGGTGAGGGCAGCACTCATCCATGTTGTAAC
JMFN014C15+ ACCAAAACCATCCAAGCAAGTATCCTCATTGGTGAGGGCAGCACTCATCCATGTTGTAAC
                      ____________________________________________________________
consensus ACCAAAACCATCCAAGCAAGTATCCTCATTGGTGAGGGCAGCACTCATCCATGTTGTAAC
 
. : . : . : . : . : . :
JMFN020F17+ ATCTCCCATTTGTGTGGTGAAATTCTTGGCATTCAGCTTTCTCAGCACCCCGAGTGACCT
JMFN014C15+ ATCTCCCATTTGTGTGGTGAAATTCTTGGCATTCAGCTTTCTCAGCACCCCGAGTGACCT
                      ____________________________________________________________
consensus ATCTCCCATTTGTGTGGTGAAATTCTTGGCATTCAGCTTTCTCAGCACCCCGAGTGACCT
 
. : . : . : . : . : . :
JMFN020F17+ GTGAAGGCTGTCCAGGGCATCCTCGAAGCACTCGACGCAGTCCCCCAACGCTATCTGGCT
JMFN014C15+ GTGAAGGCTGTCCAGGGCATCCTCGAAGCACTCGACGCAGTCCCCCAACGCTATCTGGCT
                      ____________________________________________________________
consensus GTGAAGGCTGTCCAGGGCATCCTCGAAGCACTCGACGCAGTCCCCCAACGCTATCTGGCT
 
. : . : . : . : . : . :
JMFN020F17+ TCTTCCTCTTAGGGAACCCTGGTTTTTCAATTTTGAAAGTGACCCCGCAATGGCCTTGAC
JMFN014C15+ TCTTCCTCTTAGGGAACCCTGGCTTTTCAATTTTGAAAGTGACCCCGCAATGGCCTTGAC
                      ____________________________________________________________
consensus TCTTCCTCTTAGGGAACCCTGGTTTTTCAATTTTGAAAGTGACCCCGCAATGGCCTTGAC
 
. : . : . : . : . : . :
JMFN020F17+ TTGACGTATGGTCACAGATAGCCCTACCCGTGCCCATCTGTCAGGGTGGTTTTTGGCCTT
JMFN014C15+ TTGACGTATGGTCACAGATAGCCCTACCCGTGCCCATCTGTCAGGGTGGTTTTTGGCCTT
                      ____________________________________________________________
consensus TTGACGTATGGTCACAGATAGCCCTACCCGTGCCCATCTGTCAGGGTGGTTTTTGGCCTT
 
. : . : . : . : . : . :
JMFN020F17+ GTTGGAAAACGNGTGCGAGGGAGTGTATGCAGAGGTCCTGGTGTATAGTCACACTGCAAG
JMFN014C15+ GTTGGAAAACG-GTGCGAGGGAGTGTATGCAGAGGTCCTGGTGTATAGTCACACTGCAAG
                      ____________________________________________________________
consensus GTTGGAAAACGNGTGCGAGGGAGTGTATGCAGAGGTCCTGGTGTATAGTCACACTGCAAG
 
. : . : . : . : . : . :
JMFN020F17+ CATCACGCACGTATCTTCCTCCTCCTCCTCCACCTCCACC
JMFN014C15+ CATCACGCACGTATCTTCCTCCTCCTCCTCCACCTCCACCTCCATGGCAAGCTGGGGCTA
                      ____________________________________________________________
consensus CATCACGCACGTATCTTCCTCCTCCTCCTCCACCTCCACCTCCATGGCAAGCTGGGGCTA
 
. : . : . : . : . : . :
JMFN014C15+ TCCATGCTAGGACAAGCATGAATTTCCAGAGAATGTTATGAAATGGCAACATGGTATTGG
                      ____________________________________________________________
consensus TCCATGCTAGGACAAGCATGAATTTCCAGAGAATGTTATGAAATGGCAACATGGTATTGG