Previous Contig 002435:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026C04Sequence555002435 (13)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.586002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN014B01Sequence616002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFS116B12Sequence516002435 (13)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF012K22Sequence259002435 (13)gb:AB183301_15292811e-08Lactuca sativa LetH4 mRNA for histone H4, partial cds.584002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF021L11Sequence633002435 (13)gb:AY389648_11782722e-38Hyacinthus orientalis histone H4 mRNA, complete cds.588002435 (13)gb:AY389648_11782722e-38Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF022L11Sequence633002435 (13)gb:AY389648_11782722e-38Hyacinthus orientalis histone H4 mRNA, complete cds.588002435 (13)gb:AY389648_11782722e-38Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF028J09Sequence629002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.582002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF047C23Sequence583002435 (13)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022L11- GACCCGA
rJMSF028J09+ GGA
JMSF028J09- GGA
rJMSF022L11+ GACCCGA
rJMFF026C04+ GA
rJMSF047C23+ GGA
rJMSF012K22+ GGA
rJMSF021L11+ GACCCGA
JMFF026C04- GA
JMSF012K22- GGA
JMSF021L11- GACCCGA
                      ____________________________________________________________
consensus GACCGGA
 
. : . : . : . : . : . :
JMSF022L11- ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMSF028J09+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
JMSF028J09- ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMSF022L11+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMFF026C04+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMSF047C23+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMSF012K22+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
rJMSF021L11+ ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
JMFF026C04- ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
JMSF012K22- ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
JMSF021L11- ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
JMFN014B01+ GCAACAACTTTTATAC
                      ____________________________________________________________
consensus ATACACTCTTCATTGTCGTTCCAATTTGAGCTTCAGGCCATTCTGCAACAACTTTTATAC
 
. : . : . : . : . : . :
JMSF022L11- ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMSF028J09+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
JMSF028J09- ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMSF022L11+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMFF026C04+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMSF047C23+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMSF012K22+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
rJMSF021L11+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
JMFF026C04- ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
JMSF012K22- ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
JMSF021L11- ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
JMFS116B12- GAATGTCGGGTCGGGGAAAA
JMFN014B01+ ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
                      ____________________________________________________________
consensus ACTTCTCAGTTTTAGGAATTTGTAGTTGGGTGTCTGTTCAGAATGTCGGGTCGGGGAAAA
 
. : . : . : . : . : . :
JMSF022L11- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMSF028J09+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMSF028J09- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMSF022L11+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMFF026C04+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMSF047C23+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMSF012K22+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
rJMSF021L11+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMFF026C04- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMSF012K22- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMSF021L11- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMFS116B12- GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
JMFN014B01+ GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
                      ____________________________________________________________
consensus GGAGGCAAGGGATTGGGAAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGATAAC
 
. : . : . : . : . : . :
JMSF022L11- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMSF028J09+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
JMSF028J09- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMSF022L11+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMFF026C04+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMSF047C23+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMSF012K22+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
rJMSF021L11+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
JMFF026C04- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
JMSF012K22- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAAAGGCGGCGTGAAGCGT
JMSF021L11- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
JMFS116B12- ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
JMFN014B01+ ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
                      ____________________________________________________________
consensus ATCCAGGGTATAACCAAGCCGGCCATCCGTAGGCTGGCCCGTAGAGGCGGCGTGAAGCGT
 
. : . : . : . : . : . :
JMSF022L11- ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCCTTCTGGAGAATGTG
rJMSF028J09+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
JMSF028J09- ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
rJMSF022L11+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCCTTCTGGAGAATGTG
rJMFF026C04+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
rJMSF047C23+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
rJMSF012K22+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
rJMSF021L11+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCCTTCTGGAGAATGTG
JMFF026C04- ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
JMSF012K22- ATCAGCGGTCTCATAT
JMSF021L11- ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCCTTCTGGAGAATGTG
JMFS116B12- ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
JMFN014B01+ ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
                      ____________________________________________________________
consensus ATCAGCGGTCTCATATACGAGGAGACTCGCGGCGTGTTGAAGATCTTTCTGGAGAATGTG
 
. : . : . : . : . : . :
JMSF022L11- ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMSF028J09+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
JMSF028J09- ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMSF022L11+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMFF026C04+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMSF047C23+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMSF012K22+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
rJMSF021L11+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
JMFF026C04- ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
JMSF021L11- ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
JMFS116B12- ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
JMFN014B01+ ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
                      ____________________________________________________________
consensus ATTAGGGATGCCGTTACCTACACGGAGCACGCCCGCCGCAAGACGGTTACTGCCATGGAT
 
. : . : . : . : . : . :
JMSF022L11- GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
rJMSF028J09+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
JMSF028J09- GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
rJMSF022L11+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
rJMFF026C04+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
rJMSF047C23+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAGTCGTT
rJMSF012K22+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
rJMSF021L11+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
JMFF026C04- GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
JMSF021L11- GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
JMFS116B12- GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
JMFN014B01+ GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
                      ____________________________________________________________
consensus GTGGTGTATGCCTTGAAAAGGCAGGGGAGGACTCTGTACGGATTCGGTGGGTGAATCGTT
 
. : . : . : . : . : . :
JMSF022L11- TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMSF028J09+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
JMSF028J09- TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMSF022L11+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMFF026C04+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMSF047C23+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMSF012K22+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
rJMSF021L11+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
JMFF026C04- TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
JMSF021L11- TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
JMFS116B12- TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
JMFN014B01+ TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
                      ____________________________________________________________
consensus TGTACTGGTTTTTTGTTATGAGTCTTGCTGTCAAGAAAATTAGAACTGTCAACAATGGCT
 
. : . : . : . : . : . :
JMSF022L11- GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
rJMSF028J09+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
JMSF028J09- GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
rJMSF022L11+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
rJMFF026C04+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
rJMSF047C23+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCCTAGGN
rJMSF012K22+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
rJMSF021L11+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
JMFF026C04- GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
JMSF021L11- GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
JMFS116B12- GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
JMFN014B01+ GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
                      ____________________________________________________________
consensus GGGCTCTTTTCTTACTCACTTTTTTGTAAATACTCATTGTTGGGTATTGTGTTCTTAGGT
 
. : . : . : . : . : . :
JMSF022L11- TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
rJMSF028J09+ TGGTTGTAGTTTAGTCACCTTAGTGTTGGTGT
JMSF028J09- TGGTTGTAGTTTAGTCACCTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
rJMSF022L11+ TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTT
rJMFF026C04+ TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTAT
rJMSF047C23+ TGGTTGTAGNTTAGTCACTTTAGTG
rJMSF012K22+ TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTT
rJMSF021L11+ TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGT
JMFF026C04- TGGTTGTAGTTTA
JMSF021L11- TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
JMFS116B12- TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
JMFN014B01+ TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
                      ____________________________________________________________
consensus TGGTTGTAGTTTAGTCACTTTAGTGTTGGTGTTGAACGCTTTATGTTTTGTTTCAGTAAT
 
. : . : . : . : . : . :
JMSF022L11- GGGAAATTTGTTGTGG
JMSF028J09- GGGAAATTTGTTGTGG
JMSF021L11- GGGAAATTTGTTGTGG
JMFS116B12- GGGAAATTTGTTGTGG
JMFN014B01+ GGGAAATTTGTTGTGGXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTCTCTCTCTC
                      ____________________________________________________________
consensus GGGAAATTTGTTGTGGNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTCTCTCTCTC