Previous Contig 002430:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013K19Sequence627002430 (6)gb:AF227623_17788612e-13Euphorbia esula unknown mRNA.
JMFN016B04Sequence551002430 (6)gb:AF227623_17788612e-13Euphorbia esula unknown mRNA.
JMFN020D21Sequence580002430 (6)gb:AF227623_17788612e-13Euphorbia esula unknown mRNA.
JMSF013F19Sequence235002430 (6)gb:AF227623_17788613e-04Euphorbia esula unknown mRNA.757004862 (6)
JMSF044N22Sequence237002430 (6)178002430 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N22+ TTTTACTATTTTGATGATATATATAATAATATGTGAGAAAAACAAATGA
JMFN016B04+ TTTTACTATTTTGATGATATATATAATAATATGTGAGAAAAACAAATGA
JMFN020D21+ AATGAGCAGGTTTTACTATTTTGATGATATATATAATAATATGTGAGAAAAACAAATGA
JMFN013K19+ ATAATAATATGTGAGAAAAACAAATGA
                      ____________________________________________________________
consensus AATGAGCAGGTTTTACTATTTTGATGATATATATAATAATATGTGAGAAAAACAAATGA
 
. : . : . : . : . : . :
JMSF044N22+ AATCAAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
JMFN016B04+ AATCAAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
JMFN020D21+ AATCAAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
rJMSF044N22- AAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
JMFN013K19+ AATCAAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
                      ____________________________________________________________
consensus AATCAAATCAAATCTGTCACAATAAGCATAGATATGTATATATGGAATGAATGGAGAAGC
 
. : . : . : . : . : . :
JMSF044N22+ AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
JMFN016B04+ AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
JMFN020D21+ AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
rJMSF044N22- AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
JMFN013K19+ AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
                      ____________________________________________________________
consensus AGAGCTAATCTTGATTAGCAGTGAAGCATCTGATCTCTCTCAGATCACTCAGCTTCCTCG
 
. : . : . : . : . : . :
JMSF044N22+ ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
JMFN016B04+ ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
JMFN020D21+ ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
rJMSF044N22- ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
JMFN013K19+ ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
                      ____________________________________________________________
consensus ACAGTAGCTTCGAGGCGGAGGAGGACGAAGCCGACGGCAACCCCAACGAGAACAAGCCCC
 
. : . : . : . : . : . :
JMSF044N22+ GG
JMFN016B04+ GGGAGGATGGCCGCAATCTTGAAAATCTCAGCCACGGCATTGCAGGTAGAAGAGAGAGCT
JMFN020D21+ GGGAGGATGGCCGCAATCTTGAAAATCTCAGCCACGGCATTGCAGGTAGAAGAGAGAGCT
rJMSF044N22- GG
JMFN013K19+ GGGAGGATGGCCGCAATCTTGAAAATCTCAGCCACGGCATTGCAGGTAGAAGAGAGAGCT
                      ____________________________________________________________
consensus GGGAGGATGGCCGCAATCTTGAAAATCTCAGCCACGGCATTGCAGGTAGAAGAGAGAGCT
 
. : . : . : . : . : . :
JMFN016B04+ CCGCCGCCGCCGCCGCCGCCTCTCCCTCTGCCCCGTGATGGGTCTCTCAGTGAGCTCACA
JMFN020D21+ CCGCCGCCGCCGCCGCCGCCTCTCCCTCTGCCCCGTGATGGGTCTCTCAGTGAGCTCACA
JMFN013K19+ CCGCCGCCGCCGCCGCCGCCTCTCCCTCTGCCCCGTGATGGGTCTCTCAGTGAGCTCACA
                      ____________________________________________________________
consensus CCGCCGCCGCCGCCGCCGCCTCTCCCTCTGCCCCGTGATGGGTCTCTCAGTGAGCTCACA
 
. : . : . : . : . : . :
JMFN016B04+ ATCTTTGCAAATGAGTGGTCAGTGCAAACAGGGAGGCCCAGAGTGGATACATGGTTATGC
JMFN020D21+ ATCTTTGCAAATGAGTGGTCAGTGCAAACAGGGAGGCCCAGAGTGGATACATGGTTATGC
JMSF013F19+ GCCCAGAGTGGATACATGGTTATGC
JMFN013K19+ ATCTTTGCAAATGAGTGGTCAGTGCAAACAGGGAGGCCCAGAGTGGATACATGGTTATGC
                      ____________________________________________________________
consensus ATCTTTGCAAATGAGTGGTCAGTGCAAACAGGGAGGCCCAGAGTGGATACATGGTTATGC
 
. : . : . : . : . : . :
JMFN016B04+ GCCTTCAGCCCTCCGAACGAGTTCAACCCACTAATGTAATTCACTTTCGTCGCCCTTTTC
JMFN020D21+ GCCTTCAGCCCTCCGAACGAGTTCAACCCACTAATGTAATTCACTTTCGTCGCCCTTTTC
JMSF013F19+ GCCTTCAGCCCTCCGAACGAGTTCAACCCACTAATGTAATTCACTTTCGTCGCCCTTTTC
JMFN013K19+ GCCTTCAGCCCTCCGAACGAGTTCAACCCACTAATGTAATTCACTTTCGTCGCCCTTTTC
                      ____________________________________________________________
consensus GCCTTCAGCCCTCCGAACGAGTTCAACCCACTAATGTAATTCACTTTCGTCGCCCTTTTC
 
. : . : . : . : . : . :
JMFN016B04+ TGGGAAGGCCTGATGGCCGTGCCGGTAACTGCACTCGCCGGAGAAAATGTAGCCGATGCA
JMFN020D21+ TGGGAAGGCCTGATGGCCGTGCCGGTAACTGCACTCGCCGGAGAAAATGTAGCCGATGCA
JMSF013F19+ TGGGAAGGCCTGATGGCCGTGCCGGTAACTGCACTCGCCGGAGAAAATGTAGCCGATGCA
JMFN013K19+ TGGGAAGGCCTGATGGCCGTGCCGGTAACTGCACTCGCCGGAGAAAATGTAGCCGATGCA
                      ____________________________________________________________
consensus TGGGAAGGCCTGATGGCCGTGCCGGTAACTGCACTCGCCGGAGAAAATGTAGCCGATGCA
 
. : . : . : . : . : . :
JMFN016B04+ GATGCAGTTGCCA
JMFN020D21+ GATGCAGTTGCCATGGCCTTCTTTACCTGATCGAACAAGTT
JMSF013F19+ GATGCAGTTGCCATGGCCTTCTTTACCTGATCGAACAAGTTAGAAGATGAGTATAGAAGT
JMFN013K19+ GATGCAGTTGCCATGGCCTTCTTTACCTGATCGAACAAGTTAGAAGATGAGTATAGAAGT
                      ____________________________________________________________
consensus GATGCAGTTGCCATGGCCTTCTTTACCTGATCGAACAAGTTAGAAGATGAGTATAGAAGT
 
. : . : . : . : . : . :
JMSF013F19+ GATAAAAACGGAAAAGAAAAGGTGTGAT
JMFN013K19+ GATAAAAACGGAAAAGAAAAGGTGTGATTGGGAGGAAATGGGTGTGAGGAGAATATTAGA
                      ____________________________________________________________
consensus GATAAAAACGGAAAAGAAAAGGTGTGATTGGGAGGAAATGGGTGTGAGGAGAATATTAGA