Previous Contig 002428:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013I05Sequence616002428 (2)pir|T47856|T478564e-68hypothetical protein T8B10.110 - Arabidopsis thaliana>gb:ATT8B10_1556450 Arabido
JMFS081E04Sequence509002428 (2)gb:RNI7578_17038818e-31Ribes nigrum mRNA for hypothetical protein pRIB5.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS081E04+ GAATAGATAAATATAACCTTATAATTTAAATCAAATAAGACTATCAAGTCAAATCATT
                      ____________________________________________________________
consensus GAATAGATAAATATAACCTTATAATTTAAATCAAATAAGACTATCAAGTCAAATCATT
 
. : . : . : . : . : . :
JMFS081E04+ TTCAAGAATCACAAGTGACATGATAAAAGTTTATTTGAAGTGAATACTGAGCCAGAAGAG
                      ____________________________________________________________
consensus TTCAAGAATCACAAGTGACATGATAAAAGTTTATTTGAAGTGAATACTGAGCCAGAAGAG
 
. : . : . : . : . : . :
JMFS081E04+ TTGAACCTCAGTTGAGTGTAGGATCATCACTCATCAGCCGCAGCCAAAAACTTTATGCCA
                      ____________________________________________________________
consensus TTGAACCTCAGTTGAGTGTAGGATCATCACTCATCAGCCGCAGCCAAAAACTTTATGCCA
 
. : . : . : . : . : . :
JMFS081E04+ AATTCACTCTGGTGCGTAAGCTCTCCAGCAGCAAACGACTGGTTCTCGCCCAAGTGGATA
                      ____________________________________________________________
consensus AATTCACTCTGGTGCGTAAGCTCTCCAGCAGCAAACGACTGGTTCTCGCCCAAGTGGATA
 
. : . : . : . : . : . :
JMFS081E04+ CATCTCCTTAAGATTGTGAATCCACAATATTCTACGTCATAAACAGTAACGCCATTCATG
JMFN013I05+ AGTAACGCCATTCATG
                      ____________________________________________________________
consensus CATCTCCTTAAGATTGTGAATCCACAATATTCTACGTCATAAACAGTAACGCCATTCATG
 
. : . : . : . : . : . :
JMFS081E04+ ACTGCAGAGAATACAGAGCCTACTCCCTCCCCATGTGTCACAAGCAACAAGTTCTCAGAT
JMFN013I05+ ACTGCAGAGAATACAGAGCCTACTCCCTCCCCATGTGTCACAAGCAACAAGTTCTCAGAT
                      ____________________________________________________________
consensus ACTGCAGAGAATACAGAGCCTACTCCCTCCCCATGTGTCACAAGCAACAAGTTCTCAGAT
 
. : . : . : . : . : . :
JMFS081E04+ GGATATTTATCAGCAAGTGCCTTAACAACCTCCATGTACCGAGCCCTTGCAGCTGGCGCG
JMFN013I05+ GGATATTTATCAGCAAGTGCCTTAACAACCTCCATGTACCGAGCCCTTGCAGCTGGCGCG
                      ____________________________________________________________
consensus GGATATTTATCAGCAAGTGCCTTAACAACCTCCATGTACCGAGCCCTTGCAGCTGGCGCG
 
. : . : . : . : . : . :
JMFS081E04+ GTCTCTTCCCACTCTGGTAACTTCTCGTAGACTCGTTCTGCACTGTGATCTATAGTTCCA
JMFN013I05+ GTCTCTTCCCACTCTGGTAACTTCTCGTAGACTCGTTCTGCACTGTGATCTATAGTTCCA
                      ____________________________________________________________
consensus GTCTCTTCCCACTCTGGTAACTTCTCGTAGACTCGTTCTGCACTGTGATCTATAGTTCCA
 
. : . : . : . : . : . :
JMFS081E04+ GTTGGTAACTGAGCTTCACATTCAGAGATAT
JMFN013I05+ GTTGGTAACTGAGCTTCACATTCAGAGATATTGAATTTAAAATCTCCATCCTTTGGAGCT
                      ____________________________________________________________
consensus GTTGGTAACTGAGCTTCACATTCAGAGATATTGAATTTAAAATCTCCATCCTTTGGAGCT
 
. : . : . : . : . : . :
JMFN013I05+ ACATTAGCTCTTATTGCTTGTCGGTTCAACATTTCACATAATCCTATTTCAATAGAAACC
                      ____________________________________________________________
consensus ACATTAGCTCTTATTGCTTGTCGGTTCAACATTTCACATAATCCTATTTCAATAGAAACC
 
. : . : . : . : . : . :
JMFN013I05+ TTGATTTTGGAAAGATCGGCATCGGAAGAGAGATTATTGGGATCGGCGACGGTGCAGAGA
                      ____________________________________________________________
consensus TTGATTTTGGAAAGATCGGCATCGGAAGAGAGATTATTGGGATCGGCGACGGTGCAGAGA
 
. : . : . : . : . : . :
JMFN013I05+ GCTCGGACCGCCTCGGATGCGGTCTGGAGGCAGCGAAGAAATGGAGAAACGAAGGCGCGG
                      ____________________________________________________________
consensus GCTCGGACCGCCTCGGATGCGGTCTGGAGGCAGCGAAGAAATGGAGAAACGAAGGCGCGG
 
. : . : . : . : . : . :
JMFN013I05+ TTGATCGGGGCCCCGAGATTTTGGCGGAGGCTCTGGCCAGTTGTGAAGGCTCGGGTCTTG
                      ____________________________________________________________
consensus TTGATCGGGGCCCCGAGATTTTGGCGGAGGCTCTGGCCAGTTGTGAAGGCTCGGGTCTTG
 
. : . : . : . : . : . :
JMFN013I05+ CCGTCTTGGTGGAGCGGCGGATCCCAGGGCCGTTGGGACTGGGTAATCCAGAGCGGGTCA
                      ____________________________________________________________
consensus CCGTCTTGGTGGAGCGGCGGATCCCAGGGCCGTTGGGACTGGGTAATCCAGAGCGGGTCA
 
. : . : . : . : . : . :
JMFN013I05+ ACGTTGTCGAGGCGGTCTCCATGCCTCATGACGACGATGTACTGGTAAACTTGCTCTTTC
                      ____________________________________________________________
consensus ACGTTGTCGAGGCGGTCTCCATGCCTCATGACGACGATGTACTGGTAAACTTGCTCTTTC