Previous Contig 002427:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013H19Sequence573002427 (6)sp|Q39230|SYS_ARATH2e-50Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7
JMSF006I06Sequence332008106 (5)sp|Q39230|SYS_ARATH3e-25Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7549002427 (6)sp|Q39230|SYS_ARATH8e-62Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7
JMSF010J06Sequence332008106 (5)sp|Q39230|SYS_ARATH2e-13Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7769002427 (6)sp|Q39230|SYS_ARATH2e-99Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7
JMSF033B18Sequence697008106 (5)sp|O81983|SYS_HELAN1e-73Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|T31430|T3755002427 (6)sp|Q39230|SYS_ARATH7e-86Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7
JMSF036E22Sequence699008106 (5)sp|O81983|SYS_HELAN1e-73Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|T31430|T3687002427 (6)sp|Q39230|SYS_ARATH2e-73Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|S71293|S7
JMSF052G03Sequence642008106 (5)sp|O81983|SYS_HELAN6e-49Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|T31430|T3936002427 (6)sp|O81983|SYS_HELANe-128Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS).>pir|T31430|T3

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052G03+ AATCATGTTTGCCCTTGATTTTTTGAGAAAAAG
                      ____________________________________________________________
consensus AATCATGTTTGCCCTTGATTTTTTGAGAAAAAG
 
. : . : . : . : . : . :
rJMSF052G03+ GGGATACTCTCGGTTGCAAACTCCTTTCTTCATGAGGCAAGATATCATGGGAAAATGTGC
                      ____________________________________________________________
consensus GGGATACTCTCGGTTGCAAACTCCTTTCTTCATGAGGCAAGATATCATGGGAAAATGTGC
 
. : . : . : . : . : . :
rJMSF052G03+ TCAACTAGCACAATTTGATGAGGAACTCTACAAGGTAACTGGTGAGGGAGATGACAAATA
                      ____________________________________________________________
consensus TCAACTAGCACAATTTGATGAGGAACTCTACAAGGTAACTGGTGAGGGAGATGACAAATA
 
. : . : . : . : . : . :
rJMSF052G03+ TCTAATTGCGACATCTGAACAGCCTCTGTGTGCTTATCATATGGATGATTGGATTCATCC
rJMSF010J06+ TGAACAGCCTCTGTGTGCTTATCATATGGATGATTGGATTCATCC
                      ____________________________________________________________
consensus TCTAATTGCGACATCTGAACAGCCTCTGTGTGCTTATCATATGGATGATTGGATTCATCC
 
. : . : . : . : . : . :
rJMSF052G03+ CTCAGAGCTACCATTAAGATATGCAGGATATTCGACTTGCTTTCGTAAAGAAGCTGGTTC
rJMSF010J06+ CTCAGAGCTACCATTAAGATATGCAGGATATTCGACTTGCTTTCGTAAAGAAGCTGGTTC
rJMSF036E22+ CGTAAAGAAGCTGGTTC
rJMSF033B18+ ATATGCAGGATNTTCGACTTGCTTTCGTAAAGAAGCTGGTTC
                      ____________________________________________________________
consensus CTCAGAGCTACCATTAAGATATGCAGGATATTCGACTTGCTTTCGTAAAGAAGCTGGTTC
 
. : . : . : . : . : . :
rJMSF052G03+ TCATGGCCGTGACACTCTTGGGATTTTTCGTGTTCATCAATTTGAAAAAGTTGAGCAATT
rJMSF010J06+ TCATGGCCGTGACACTCTTGGGATTTTTCGTGTTCATCAATTTGAAAAAGTTGAGCAATT
rJMSF036E22+ TCATGGCCGTGACACTCTTGGGA-TTTTCGTGTTCATCAATTTGAAAAAGTTGAGCAATT
rJMSF033B18+ TCATGGCCGTGACACTCTTGGGATTTTTCGTGTTCATCAATTTGAAAAAGTTGAGCAATT
                      ____________________________________________________________
consensus TCATGGCCGTGACACTCTTGGGATTTTTCGTGTTCATCAATTTGAAAAAGTTGAGCAATT
 
. : . : . : . : . : . :
rJMSF052G03+ TTGTATAACTAGCCCAAATGGCAATGACTCCTGGGACATGCATGAGGAGATGTTCAAGAA
rJMSF010J06+ TTGTATAACTAGCCCAAATGGCAATGACTCCTGGGACATGCATGAGGAGATGTTCAAGAA
rJMSF036E22+ TTGTATAACTAGCCCAAATGGCAATGATTCCTGGGACATGCATGAGGAGATGTTCAAGAA
rJMSF006I06+ AAATGGCAATGATTCCTGGGACATGCATGAGGAGATGTTCAAGAA
rJMSF033B18+ TTGTATAACTAGCCCAAATGGCAATGATTCCTGGGACATGCATGAGGAGATGTTCAAGAA
                      ____________________________________________________________
consensus TTGTATAACTAGCCCAAATGGCAATGATTCCTGGGACATGCATGAGGAGATGTTCAAGAA
 
. : . : . : . : . : . :
rJMSF052G03+ CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
rJMSF010J06+ CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
rJMSF036E22+ CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
rJMSF006I06+ CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
rJMSF033B18+ CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
JMFN013H19- GATTCCCTATCATGTTGTTT-AATTGTTTCTGG
                      ____________________________________________________________
consensus CTCTGAGGAATTCTTCCAGCAGCTAAAGATTCCCTATCATGTTGTTTCAATTGTTTCTGG
 
. : . : . : . : . : . :
rJMSF052G03+ TGCATTAAATGATGCTGCTGCAAAGAAGTACGATTTAGAAGGCTGGTTCCCTGCCTCTGC
rJMSF010J06+ TGCATTAAATGATGCTGCTGCAAAGAAGTACGATTTAGAAGGCTGGTTCCCTGCCTCTGC
rJMSF036E22+ TGCATTAAATGATGCTGCTGCAAAAAAGTATGATTTAGAAGGCTGGTTCCCTGCCTCTGC
rJMSF006I06+ TGCANTAAATGATGCTGCTGCAAAAAAGTATGATTTAGAAGGCTGGTTCCCTGCCTCTGC
rJMSF033B18+ TGCATTAAATGATGCTGCTGCAAAAAAGTATGATTTAGAAGGCTGGTTCCCTGCCTCTGC
JMFN013H19- TGCATTAAATGATGCTGCTGCAAAAAAGTATGATTTAGAAGGCTGGTTCCCTGCCTCTGC
                      ____________________________________________________________
consensus TGCATTAAATGATGCTGCTGCAAAAAAGTATGATTTAGAAGGCTGGTTCCCTGCCTCTGC
 
. : . : . : . : . : . :
rJMSF052G03+ CACACACAGAGAACTTGTTTCATGCTCAAACTGCACCGATTACCAATCAAGAAGATTGGA
rJMSF010J06+ CACACACAGAGAACTTGTTTCATGCTCAAACTGCACCGATTACCAATCAAGAAGATTGGA
rJMSF036E22+ CACACATAGAGAACTTGTTTCATGCTCAAACTGCACGGATTACCAATCAAGAAGATTGGA
rJMSF006I06+ CACACATAGAGAACTTGTTTCATGCTCAAACTGCACGGATTNCCAATCAAGAAGATTGGA
rJMSF033B18+ CACACATAGAGAACTTGTTTCATGCTCAAACTGCACGGATTACCAATCAAGAAGATTGGA
JMFN013H19- CACACATAGAGAACTTGTTTCATGCTCAAACTGCACGGATTACCAATCAAGAAGATTGGA
                      ____________________________________________________________
consensus CACACATAGAGAACTTGTTTCATGCTCAAACTGCACGGATTACCAATCAAGAAGATTGGA
 
. : . : . : . : . : . :
rJMSF052G03+ AATTCGGTATGGGCAGAAAAAGGGAAATGAGCAATCGGCGAAACAATATGTTCATTTATT
rJMSF010J06+ AATTCGGTATGGGCAGAAAAAGGGAAATGAGCAATCGGCGAAACAATATGTTCATTTATT
rJMSF036E22+ AATTCGGTATGGGCAGAAAAAGGGAAATGACCAATCGGCGAAACAATATGTTCATTTATT
rJMSF006I06+ AATTCGGTATGGGCAGAAAAAGGGAAATGACCAATCGGCGAAACAATATGTTCATTTATT
rJMSF033B18+ AATTCGGTATGGGCAGAAAAAGGGAAATGACCAATCGGCGAAACAATATGTTCATTTATT
JMFN013H19- AATTCGGTATGGGCAGAAAAAGGGAAATGACCAATCGGCGAAACAATATGTTCATTTATT
                      ____________________________________________________________
consensus AATTCGGTATGGGCAGAAAAAGGGAAATGACCAATCGGCGAAACAATATGTTCATTTATT
 
. : . : . : . : . : . :
rJMSF052G03+ GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
rJMSF010J06+ GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
rJMSF036E22+ GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
rJMSF006I06+ GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
rJMSF033B18+ GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
JMFN013H19- GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
                      ____________________________________________________________
consensus GAACTCTACTTTGACGGCAACAGAGAGGACTCTCTGCTGTATCCTCGAGAATTACCAGAA
 
. : . : . : . : . : . :
rJMSF052G03+ GAAGGATGGGGTGGAGGTCCCCCAAGTATTGCAACCTTACATGGGTGGAGTCACATTCCT
rJMSF010J06+ GAAGGATGGGGTGGAGGTCCCCCAAGTATTGCAACCTTACATGGGTGGAGTCACATTCCT
rJMSF036E22+ GGAGGATGGGGTGGAGGTCCCCGAAGTATTGCAACCTTACATGGGTGGAGTGACATTCCT
rJMSF006I06+ GGAGGATGGGGTGGAGGTCCCCGAAGTATTGCAACCTTACATGGGTGGAGTGACATTCCT
rJMSF033B18+ GGAGGATGGGGTGGAGGTCCCCGAAGTATTGCAACCTTACATGGGTGGAGTGACATTCCT
JMFN013H19- GGAAGATGGGGTGGAGGTCCCCGAAGTATTGCAACCTTACATGGGTGGAGTGACATTCCT
                      ____________________________________________________________
consensus GGAGGATGGGGTGGAGGTCCCCGAAGTATTGCAACCTTACATGGGTGGAGTGACATTCCT
 
. : . : . : . : . : . :
rJMSF052G03+ TCCGTTCAAGACCGTCCCAACTGGTAAAGATAAAAAATCCAAATGACCATTTACTTACTT
rJMSF010J06+ TCCGTTCAAGACCGTCCCAACTGGTAAAGATAAAAAATCCAAATGACCATTTACTTACTT
rJMSF036E22+ CCCGTTCAAGAGCGTCCCAACTGGTAAAGATAAAAAATCCAAATGAGCATTT----ACTT
rJMSF006I06+ CCCGTTCAAGAGCGTCCCAACTGGTAAAGATAAAAAATCCAAATGAGCATTT----ACTT
rJMSF033B18+ CCCGTTCAAGAGCGTCCCAACTGGTAAAGATAAAAAATCCAAATGAGCATTT----ACTT
JMFN013H19- CCCGTTCAAGAGCGTCCCAACTGGTAAAGATAAAAAATCCAAATGAGCATTT----ACTT
                      ____________________________________________________________
consensus CCCGTTCAAGAGCGTCCCAACTGGTAAAGATAAAAAATCCAAATGAGCATTT----ACTT
 
. : . : . : . : . : . :
rJMSF052G03+ TCTAACGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAG
rJMSF010J06+ TCTAACGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAG
rJMSF036E22+ TCTAATGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAGCTGTAGCTCG
rJMSF006I06+ TCTAATGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAGCTGTAGCTCG
rJMSF033B18+ TCTAATGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAGCTGTAGCTCG
JMFN013H19- TCTAATGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAGCTGTAGCTCG
                      ____________________________________________________________
consensus TCTAATGCCTTCAAACTAGAAACAAGGCTTTAAGGAAACACTATGTCAAGCTGTAGCTCG
 
. : . : . : . : . : . :
rJMSF036E22+ GTTTTAGAAGATATAACTTAAGAATGATTGTTTGTGATCCAAATATCCAATGCCCCTTGA
rJMSF006I06+ GTTTTAGAAGATATAACTTNAGAATGAT
rJMSF033B18+ GTTTTAGAAGATATAACTTAAGAATGATTGTTTGTGATCCAAATATCCAATGCCCCTTGA
JMFN013H19- GTTTTAGAAGATATAACTTAAGAATGATTGTTTGTGATCCAAATATCCAATGCCCCTTGA
                      ____________________________________________________________
consensus GTTTTAGAAGATATAACTTAAGAATGATTGTTTGTGATCCAAATATCCAATGCCCCTTGA
 
. : . : . : . : . : . :
rJMSF036E22+ GACTGATT
rJMSF033B18+ GACTGATTTGAGAAGCTGTCGTTGCACAGTAATGGCTTACTGCGGAAATATTTCAGA
JMFN013H19- GACTGATTTGAGAAGCTGTCGTTGCACAGTAATGGCTTACTGCGGAAATATTTCAGATAC
                      ____________________________________________________________
consensus GACTGATTTGAGAAGCTGTCGTTGCACAGTAATGGCTTACTGCGGAAATATTTCAGATAC