Previous Contig 002426:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013H04Sequence627002426 (4)gb:AB008268_15104475e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.>gb:AY056220_15635
JMFN015F11Sequence617002426 (4)gb:AB008268_15104475e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.>gb:AY056220_15635
JMFN032J20Sequence419002426 (4)gb:AB008268_15104476e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1.>gb:AY056220_15635
JMFS122F08Sequence354002426 (4)gb:AY085668_15707355e-16Arabidopsis thaliana clone 16835 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS122F08- GGAAGGCAAGGACTATTGAGTATTACAGAAAAGAATCAGCTTTGAAAGA
JMFN032J20+ ACAGAAAAGAATCAGCTTTGAAAGA
JMFN015F11+ AGGCAAGGACTATTGAGTATTACAGAAAAGAATCAGCTTTGAAAGA
JMFN013H04+ ACAGAAAAGAATCAGCTTTGAAAGA
                      ____________________________________________________________
consensus GGAAGGCAAGGACTATTGAGTATTACAGAAAAGAATCAGCTTTGAAAGA
 
. : . : . : . : . : . :
JMFS122F08- ATCTTTGCAATACACAATAATGGGAAGATACATGATGTTATGTTATAGGGGAAAACCAAT
JMFN032J20+ ATCTTTGCAATACACAATAATGGGAAGATACATGATGTTATGTTATAGGGGAAAACCAAT
JMFN015F11+ ATCTTTGCAATACACAATAATGGGAAGATACATGATGTTATGTTATAGGGGAAAACCAAT
JMFN013H04+ ATCTNTGCAATACACAATAATGGGAAGATACATGATGTTATGTTATAGGGGAAAACCAAT
                      ____________________________________________________________
consensus ATCTTTGCAATACACAATAATGGGAAGATACATGATGTTATGTTATAGGGGAAAACCAAT
 
. : . : . : . : . : . :
JMFS122F08- TCTAATCATCTATGGAGTGTGAATCCCTGCCCCCGAGAGTCTGAATTATGGCCTCGAGGA
JMFN032J20+ TCTAATCATCTATGGAGTGTGAATCCCTGCCCCCGAGAGTCTGAATTATGGCCTCGAGGA
JMFN015F11+ TCTAATCATCTATGGAGTGTGAATCCCTGCCCCCGAGAGTCTGAATTATGGCCTCGAGGA
JMFN013H04+ TCTAATCATCTATGGAGTGTGAATCCCTGCCCCCGAGAGTCTGAATTATGGCCTCGAGGA
                      ____________________________________________________________
consensus TCTAATCATCTATGGAGTGTGAATCCCTGCCCCCGAGAGTCTGAATTATGGCCTCGAGGA
 
. : . : . : . : . : . :
JMFS122F08- GTTTGATTTCTTTATCACGCTTTGCAATCTCGTCCTGCTTTGCACGTAACTCTTCCATGT
JMFN032J20+ GTTTGATTTCTTTATCACGCTTTGCAATCTCGTCCTGCTTTGCACGTAACTCTTCCATGT
JMFN015F11+ GTTTGATTTCTTTATCACGCTTTGCAATCTCGTCCTGCTTTGCACGTAACTCTTCCATGT
JMFN013H04+ GTTTGATTTCTTTATCACGCTTTGCAATCTCGTCCTGCTTTGCACGTAACTCTTCCATGT
                      ____________________________________________________________
consensus GTTTGATTTCTTTATCACGCTTTGCAATCTCGTCCTGCTTTGCACGTAACTCTTCCATGT
 
. : . : . : . : . : . :
JMFS122F08- GCAGTGCAAAAACTTTTGTGGTATTTTCAAGCTCTTTTGTGATCTCTTGTGCCTGTAGTT
JMFN032J20+ GCAGTGCAAAAACTTTTGTGGTATTTTCAAGCTCTTTTGTGATCTCTTGTGCCTGTAGTT
JMFN015F11+ GCAGTGCAAAAACTTTTGTGGTATTTTCAAGCTCTTTTGTGATCTCTTGTGCCTGTAGTT
JMFN013H04+ GCAGTGCAAAAACTTTTGTGGTATTTTCAAGCTCTTTTGTGATCTCTTGTGCCTGTAGTT
                      ____________________________________________________________
consensus GCAGTGCAAAAACTTTTGTGGTATTTTCAAGCTCTTTTGTGATCTCTTGTGCCTGTAGTT
 
. : . : . : . : . : . :
JMFS122F08- CTGCAGCCTTCTGAGCTGCCTCTGCTTGTCGTTTCTCTGTCCGTGCACGAGCAGCAGCTG
JMFN032J20+ CTGCAGCCTTCTGAGCTGCCTCTGCTTGTCGTTTCTCTGTCCGTGCACGAGCAGCAGCTG
JMFN015F11+ CTGCAGCCTTCTGAGCTGCCTCTGCTTGTCGTTTCTCTGTCCGTGCACGAGCAGCAGCTG
JMFN013H04+ CTGCAGCCTTCTGAGCTGCCTCTGCTTGTCGTTTCTCTGTCCGTGCACGAGCAGCAGCTG
                      ____________________________________________________________
consensus CTGCAGCCTTCTGAGCTGCCTCTGCTTGTCGTTTCTCTGTCCGTGCACGAGCAGCAGCTG
 
. : . : . : . : . : . :
JMFS122F08- AAATG
JMFN032J20+ AAATGGCAGAATCTAGTTCCCGTTCTAAAGTCTCAACTCTCTGCTCAAGAACCTTGATGG
JMFN015F11+ AAATGGCAGAATCTAGTTCCCGTTCTAAAGTCTCAACTCTCTGCTCAAGAACCTTGATGG
JMFN013H04+ AAATGGCAGAATCTAGTTCCCGTTCTAAAGTCTCAACTCTCTGCTCAAGAACCTTGATGG
                      ____________________________________________________________
consensus AAATGGCAGAATCTAGTTCCCGTTCTAAAGTCTCAACTCTCTGCTCAAGAACCTTGATGG
 
. : . : . : . : . : . :
JMFN032J20+ TTCGGGCTTGTTCGGAGATGAGATAGGCTTTTGA
JMFN015F11+ TTCGGGCTTGTTCGGAGATGAGATAGGCTTTTGAGTATGTGTCTTCGTCGACATAGACCG
JMFN013H04+ TTCGGGCTTGTTCGGAGATGAGATAGGCTTTTGAGTATGTGTCTTCGTCGACATAGACCG
                      ____________________________________________________________
consensus TTCGGGCTTGTTCGGAGATGAGATAGGCTTTTGAGTATGTGTCTTCGTCGACATAGACCG
 
. : . : . : . : . : . :
JMFN015F11+ CTTTCTTGATAAGCAGTTTTTGCAGGGAGTCAAGATTGCCTGCCATCTCTGAGAAATTCG
JMFN013H04+ CTTTCTTGATAAGCAGTTTTTGCAGGGAGTCAAGATTGCCTGCCATCTCTGAGAAATTCG
                      ____________________________________________________________
consensus CTTTCTTGATAAGCAGTTTTTGCAGGGAGTCAAGATTGCCTGCCATCTCTGAGAAATTCG
 
. : . : . : . : . : . :
JMFN015F11+ CGATCGCAGCCGTCCATCTCTCACTCCCTTTGCCTTTCTCCTCCATTATCAGCTGATGCT
JMFN013H04+ CGATCGCAGCCGTCCATCTCTCACTCCCTTTGCCTTTCTCCTCCATTATCAGCTGATGCT
                      ____________________________________________________________
consensus CGATCGCAGCCGTCCATCTCTCACTCCCTTTGCCTTTCTCCTCCATTATCAGCTGATGCT
 
. : . : . : . : . : . :
JMFN015F11+ CTCTCTTGCTTCCGTAATGGCGGTAATGCTT
JMFN013H04+ CTCTCTTGCTTCCGTAATGGCGGTAATGCTTGTCGTCACGGTTGCTGACTTGCTGGGGGT
                      ____________________________________________________________
consensus CTCTCTTGCTTCCGTAATGGCGGTAATGCTTGTCGTCACGGTTGCTGACTTGCTGGGGGT