Previous Contig 002416:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN012O21Sequence544002416 (3)
JMFN014A18Sequence553002416 (3)
JMFN036C06Sequence543002416 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN036C06+ G
JMFN014A18+ G
JMFN012O21+ AAAG
                      ____________________________________________________________
consensus AAAG
 
. : . : . : . : . : . :
JMFN036C06+ TTAAAAGGATTTTATTATGAGACGATTTTACATATAAGCACGTAGAGGTGCAAACGCTCT
JMFN014A18+ TTAAAAGCATTTTATTATTAGACGATTTTACATATAAGCACGTAGAGGTGCACACGCTCT
JMFN012O21+ TTAAAAGGATTTTATTATGAGACGATTTTACATATAAGCACGTAGAGGTGCAAACGCTCT
                      ____________________________________________________________
consensus TTAAAAGGATTTTATTATGAGACGATTTTACATATAAGCACGTAGAGGTGCAAACGCTCT
 
. : . : . : . : . : . :
JMFN036C06+ CTTAAAGGCCAAAATAAAATTAAAGCAATTCGTCTCCTGAGGTGATTATTGTGGCGGTGG
JMFN014A18+ ATTAAAGGCCAAAATAAAATTAAAGCAATTCGTCTCCTGAGGTGATTATTGTGGCGGTGG
JMFN012O21+ CTTAAAGGCCAAAATAAAATTAAAGCAATTCGTCTCCTGAGGTGATTATTGTGGCGGTGG
                      ____________________________________________________________
consensus CTTAAAGGCCAAAATAAAATTAAAGCAATTCGTCTCCTGAGGTGATTATTGTGGCGGTGG
 
. : . : . : . : . : . :
JMFN036C06+ GGAAATATAGTAACAGATGAGATGAGATGAGATCAAGCACAATAGCCGTCTAAAATAATT
JMFN014A18+ GGAAATATAGTAACAGATGAGATGAGATGAGATCAAGCCCAATAGCCGTCTAAAATAATT
JMFN012O21+ GGAAATATAGTAACAGATGAGATGAGATGAGATCAAGCACAATAGCCGTCTAAAATAATT
                      ____________________________________________________________
consensus GGAAATATAGTAACAGATGAGATGAGATGAGATCAAGCACAATAGCCGTCTAAAATAATT
 
. : . : . : . : . : . :
JMFN036C06+ TTCTCACAACCGGCCGTTGCTGGACAGTCCCGACAATCTGCGTCAGTTTCACACTTCCCA
JMFN014A18+ TTCTCACAACCGGCCGTTGTTGGACAGTCCCGACAATCTGCGTCAGTTTCACACTTCCCA
JMFN012O21+ TTCTCACAACCGGCCGTTGCTGGACAGTCCCGACAATCTGCGTCAGTTTCACACTTCCCA
                      ____________________________________________________________
consensus TTCTCACAACCGGCCGTTGCTGGACAGTCCCGACAATCTGCGTCAGTTTCACACTTCCCA
 
. : . : . : . : . : . :
JMFN036C06+ CAACCAAGGATCGCCTTGCTCTTCTTCGTTTCCGATGCCAGAACCAGAGTGGAACCAAAT
JMFN014A18+ CAACCAAGGATCGCCTTGCTCTTCTTCGTTTCCGATGCCAGAACCAGAGTGGAACCAAAT
JMFN012O21+ CAACCAAGGATCGCCTTGCTCTTCTTCGTTTCCGATGCCAGAACCAGAGTGGAACCAAAT
                      ____________________________________________________________
consensus CAACCAAGGATCGCCTTGCTCTTCTTCGTTTCCGATGCCAGAACCAGAGTGGAACCAAAT
 
. : . : . : . : . : . :
JMFN036C06+ CCAACACAATGACCCATTTCAGATCCAGAGATTTTGTTGATGCAGAAATTGGTAGAGTAA
JMFN014A18+ CCAACACAATGACCCATTTCAGATCCAGAGATTTTGTTGATGCAGAAATTGGTAGAGTAA
JMFN012O21+ CCAACACAATGACCCATTTCAGATCCAGAGATTTTGTTGATGCAGAAATTGGTAGAGTAA
                      ____________________________________________________________
consensus CCAACACAATGACCCATTTCAGATCCAGAGATTTTGTTGATGCAGAAATTGGTAGAGTAA
 
. : . : . : . : . : . :
JMFN036C06+ ACGCTGTTGGCTTTGCAGTCATCATGGGACTTGCAAAGTTGTCCAGTCATGAACAACTGC
JMFN014A18+ ACGCTGTTGGCTTTGCAGTCTTCATGGGACTTGCAAAGTTGTCCAATCATGAACAACTGC
JMFN012O21+ ACGCTGTTGGCTTTGCAGTCATCATGGGACTTGCAAAGTTGTCCAGTCATGAACAACTGC
                      ____________________________________________________________
consensus ACGCTGTTGGCTTTGCAGTCATCATGGGACTTGCAAAGTTGTCCAGTCATGAACAACTGC
 
. : . : . : . : . : . :
JMFN036C06+ TTCTTGTTTGGTCCTACAGATATTTGTGCCATCAAACTTGATGGCAACAAAGATGCAACC
JMFN014A18+ TTCTTGTTTGGTCCTACAGATATTTGTGCCATCATACTTGATGGCAACAAAGATGCAACC
JMFN012O21+ TTCTTGTTTGGTCCTACAGATATTTGTGCCATCAAACTTGATGGCAACAAAGATGCAACC
                      ____________________________________________________________
consensus TTCTTGTTTGGTCCTACAGATATTTGTGCCATCAAACTTGATGGCAACAAAGATGCAACC
 
. : . : . : . : . : . :
JMFN036C06+ ATGAAAAGCAATAGGAAGCAAGCTGGCTTGATTGAAACTCTCTCCATTATCTCTTGTT
JMFN014A18+ ATGAAAAG
JMFN012O21+ ATGAAAAGCAATAGGAAGCAAGCTGGCTTGATTGAAACTCTCTCCATTATCTCTTGTTGT
                      ____________________________________________________________
consensus ATGAAAAGCAATAGGAAGCAAGCTGGCTTGATTGAAACTCTCTCCATTATCTCTTGTTGT