Previous Contig 002413:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN012I03Sequence610002413 (8)gb:AB026639_15170782e-12Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:BT005632_16
JMFN029G06Sequence622002413 (8)gb:AB026639_15170781e-15Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:BT005632_16
JMSF002L13Sequence364002413 (8)752002413 (8)gb:AB026639_15170783e-14Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:BT005632_16
JMSF026A06Sequence638002413 (8)gb:AB026639_15170783e-17Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:BT005632_16761002413 (8)gb:AP005008_18472106e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054
JMSF027A06Sequence616002413 (8)gb:AB026639_15170786e-16Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:BT005632_16773002413 (8)gb:AP005008_18472106e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002L13- ATTTGAACATCCACATACACGAAAAATCAAGCTTATGAATATATTACAG
                      ____________________________________________________________
consensus ATTTGAACATCCACATACACGAAAAATCAAGCTTATGAATATATTACAG
 
. : . : . : . : . : . :
rJMSF002L13- ATTAAGGAATTTAGGACGTGAACAAGAATTTGATTAAGGAATACAGGGATTACTTTTACA
                      ____________________________________________________________
consensus ATTAAGGAATTTAGGACGTGAACAAGAATTTGATTAAGGAATACAGGGATTACTTTTACA
 
. : . : . : . : . : . :
rJMSF002L13- AATAGTAGTCTTTTGCAAGTATCAAACAGCATTATTGTTGAATTTCATCTAGAGTGAAAT
JMFN029G06+ AAAT
rJMSF026A06- GTCTTTTGC-AGTATCAAACAGCATTATTGTTGAATTTCATCTAGAGTGAAAT
rJMSF027A06- GTCTTTTGC-AGTATCAAACAGCATTATTGTTGAATTTCATCTAGAGTGAAAT
                      ____________________________________________________________
consensus AATAGTAGTCTTTTGC-AGTATCAAACAGCATTATTGTTGAATTTCATCTAGAGTGAAAT
 
. : . : . : . : . : . :
rJMSF002L13- CCAATTAGCATTAGAAGGTACAAGCACAGGTTGTATAAAAAGTTATCCCTGAGGATGGGA
JMFN029G06+ CCAATTAGCATTAGAAGGTACAAGCACAGGTTGTATAAAAAGTTATCCCTGAGGATGGGA
rJMSF026A06- CCAATTAGCATTAGAAGGTACAAGCACAGGTTGTATAAAAAGTTATCCCTGAGGATGGGA
rJMSF027A06- CCAATTAGCATTAGAAGGTACAAGCACAGGTTGTATAAAAAGTTATCCCTGAGGATGGGA
                      ____________________________________________________________
consensus CCAATTAGCATTAGAAGGTACAAGCACAGGTTGTATAAAAAGTTATCCCTGAGGATGGGA
 
. : . : . : . : . : . :
rJMSF002L13- GAAAAAGGAAAGGAAAGGAAAGGAAAGGAGATGATACATTTTGGCAATGACTAAGAAGTC
JMFN029G06+ GAAAAAGGAAAGGAAAGGAAAGGAAAGGAGATGATACATTTTGGCAATGACTAAGAAGTC
rJMSF026A06- GAAAAAGGAAAGGAAAGGAAAGGAAAGGAGATGATACATTTTGGCAATGACTAAGAAGTC
rJMSF027A06- GAAAAAGGAAAGGAAAGGAAAGGAAAGGAGATGATACATTTTGGCAATGACTAAGAAGTC
                      ____________________________________________________________
consensus GAAAAAGGAAAGGAAAGGAAAGGAAAGGAGATGATACATTTTGGCAATGACTAAGAAGTC
 
. : . : . : . : . : . :
rJMSF002L13- AAACGAGCAAGAGCATCCTGGGCGGCGGAGTAGTCTGGCTGGATTTTAAGAGCGTCTTCG
JMFN029G06+ AAACGAGCAAGAGCATCCTGGGCGGCGGAGTAGTCTGGCTGGATTTTAAGAGCGTCTTCG
rJMSF026A06- AAACGAGCAAGAGCATCCTGGGCGGCGGAGTAGTCTGGCTGGATTTTAAGAGCGTCTTCG
rJMSF027A06- AAACGAGCAAGAGCATCCTGGGCGGCGGAGTAGTCTGGCTGGATTTTAAGAGCGTCTTCG
JMSF026A06+ TTCG
                      ____________________________________________________________
consensus AAACGAGCAAGAGCATCCTGGGCGGCGGAGTAGTCTGGCTGGATTTTAAGAGCGTCTTCG
 
. : . : . : . : . : . :
rJMSF002L13- TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
JMFN029G06+ TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
rJMSF026A06- TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
rJMSF027A06- TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
JMSF027A06+ TCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
JMSF026A06+ TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
JMFN012I03+ TAACAGACAA
                      ____________________________________________________________
consensus TAAGACTTTCGGGCCTCCTCGCTCAGCTCTTTCTTTTCATAGCACTCTCCTAACAGACAA
 
. : . : . : . : . : . :
rJMSF002L13- AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
JMFN029G06+ AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
rJMSF026A06- AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
rJMSF027A06- AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
JMSF027A06+ AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
JMSF026A06+ AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
JMFN012I03+ AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
                      ____________________________________________________________
consensus AGCCCCTTGACATTATCGCCCTTCAACCGCACCGACTCGATCAGATCCTCAACGGCCGAG
 
. : . : . : . : . : . :
rJMSF002L13- TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
JMFN029G06+ TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
rJMSF026A06- TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
rJMSF027A06- TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
JMSF027A06+ TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
JMSF026A06+ TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
JMFN012I03+ TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
                      ____________________________________________________________
consensus TCAATTTGCTCGCCCTTACTCACCGCGAGCTTCAATTCCGCCCGTTTGTGCAGCGCTTCC
 
. : . : . : . : . : . :
rJMSF002L13- GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
JMFN029G06+ GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
rJMSF026A06- GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
rJMSF027A06- GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
JMSF027A06+ GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
JMSF026A06+ GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
JMFN012I03+ GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
                      ____________________________________________________________
consensus GCCCTCTCGGGGAGGCTGAGCGACTTCGCCGCCAGCGGCGACAGCGCGACGTTCATCGCG
 
. : . : . : . : . : . :
rJMSF002L13- TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
JMFN029G06+ TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
rJMSF026A06- TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
rJMSF027A06- TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
JMSF027A06+ TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
JMSF026A06+ TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
JMSF002L13+ TCCAGAGCCATAGCCTTGAGCAAATGAAGA
JMFN012I03+ TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
                      ____________________________________________________________
consensus TCGAGAGCTGAGGTCTTGAACCCCTGCACCTCCAGAGCCATAGCCTTGAGCAAATGAAGA
 
. : . : . : . : . : . :
rJMSF002L13- GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
JMFN029G06+ GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
rJMSF026A06- GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
rJMSF027A06- GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
JMSF027A06+ GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
JMSF026A06+ GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
JMSF002L13+ GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
JMFN012I03+ GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
                      ____________________________________________________________
consensus GCGGCGTCCTTGGCGTCGATGCCGATGGCTTTCTCGGCTTCTTCTTCGGCTGACTTGGCC
 
. : . : . : . : . : . :
rJMSF002L13- AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGG
JMFN029G06+ AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
rJMSF026A06- AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
rJMSF027A06- AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
JMSF027A06+ AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
JMSF026A06+ AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
JMSF002L13+ AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
JMFN012I03+ AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
                      ____________________________________________________________
consensus AGCGTCATCCTCATCGACGACGACAGGTCCTTGGCCGTCCTGGCTTGAGCCAGACGCTGC
 
. : . : . : . : . : . :
JMFN029G06+ GCGCCTAGGACGAAGTGG
rJMSF026A06- GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
rJMSF027A06- GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
JMSF027A06+ GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
JMSF026A06+ GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
JMSF002L13+ GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
JMFN012I03+ GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
                      ____________________________________________________________
consensus GCGCCTAGGACGAAGTGGCGCCTGGCTTGGATAGTACGGGCTTGTCTCCGCATCTGCAGC
 
. : . : . : . : . : . :
rJMSF026A06- TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGA
rJMSF027A06- TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
JMSF027A06+ TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
JMSF026A06+ TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
JMSF002L13+ TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
JMFN012I03+ TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
                      ____________________________________________________________
consensus TTAGAGTAGAGATTCTGGGGGATGTTATGCATAAACAGGTACGTGAAGATGGAAATCAAA
 
. : . : . : . : . : . :
JMSF027A06+ ATCAGAACAGCCTGTAGAAGAAGATCGGTCCACATCTTGCTTATACTTTGATTACTTTCT
JMSF026A06+ ATCAGAACAGCCTGTAGAAGAAGATCGGTCCACATCTTGCTTATACTTTGATTACTTTCT
JMSF002L13+ ATCAGAACAGCCTGTAGAAGAAGATCGGTCCACATCTTGCTTATACTTTGATTACTTTCT
JMFN012I03+ ATCAGAACAGCCTGTAGAAGAAGATCGGTCCACATCTTGCTTATACTTTGATTACTTTCT
                      ____________________________________________________________
consensus ATCAGAACAGCCTGTAGAAGAAGATCGGTCCACATCTTGCTTATACTTTGATTACTTTCT
 
. : . : . : . : . : . :
JMSF027A06+ CTCAATTTTTCAGTAGAAATGAATGAACTTGCT
JMSF026A06+ CTCAATTTTTCAGTAGAAATGAATGAACTTGCT
JMSF002L13+ CTCAATTTTTCAGTAGAAATGAATGAACTTGCT
JMFN012I03+ CTCAATTTTTCAGTAGAAATGAATGAACTTGCTAATTCCGATCGCGGTTCGCGGAGGCCA
                      ____________________________________________________________
consensus CTCAATTTTTCAGTAGAAATGAATGAACTTGCTAATTCCGATCGCGGTTCGCGGAGGCCA