Previous Contig 002411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017C02Sequence553002411 (7)gb:AF307336_17846623e-79Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.724002411 (7)gb:AF307336_17846627e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFN007O15Sequence627002411 (7)gb:AF307336_17846625e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFN012F21Sequence627002411 (7)gb:AF307336_17846629e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFN043J03Sequence629002411 (7)gb:AF307336_17846625e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFN044G24Sequence621002411 (7)gb:AF307336_17846625e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.
JMFN045F23Sequence621002411 (7)gb:AF307336_17846625e-80Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017C02- AAAGGGAAAGCTCAGAGAG
                      ____________________________________________________________
consensus AAAGGGAAAGCTCAGAGAG
 
. : . : . : . : . : . :
rJMFF017C02- TATCAAACAATACAGGAAAGGAAATATATCTCCTAAAACAAAACTTGTTCATACTGCAAA
                      ____________________________________________________________
consensus TATCAAACAATACAGGAAAGGAAATATATCTCCTAAAACAAAACTTGTTCATACTGCAAA
 
. : . : . : . : . : . :
rJMFF017C02- TAAACTAGTGTCCAAACACAAGGAAGCAAAAGAAAGTATCAGAATCGTTCAATTCTTGAA
JMFN007O15+ AAGTATCAGAATCGTTCAATTCTTGAA
JMFN045F23+ CAGAATCGTTCAATTCTTGAA
JMFN044G24+ CAGAATCGTTCAATTCTGAAN
JMFN012F21+ AAGTATCAGAATCGTTCAATTCTTGAA
                      ____________________________________________________________
consensus TAAACTAGTGTCCAAACACAAGGAAGCAAAAGAAAGTATCAGAATCGTTCAATTCTTGAA
 
. : . : . : . : . : . :
rJMFF017C02- GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTCCTAGCCTTGCTGGT
JMFN043J03+ TAAGCCTTCCTAGCCTTGCTGGT
JMFN007O15+ GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTCCTAGCCTTGCTGGT
JMFN045F23+ GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTCCTAGCCTTGCTGGT
JMFN044G24+ GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTCCTAGCCTTGCTGGT
JMFN012F21+ GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTGCTAGCCTTGCTGGT
                      ____________________________________________________________
consensus GGTTTGTAAATCACTGGTGAAAAAAGCACAGATGCCTTAAGCCTTCCTAGCCTTGCTGGT
 
. : . : . : . : . : . :
JMFF017C02+ TGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
rJMFF017C02- TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
JMFN043J03+ TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
JMFN007O15+ TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
JMFN045F23+ TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
JMFN044G24+ TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
JMFN012F21+ TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
                      ____________________________________________________________
consensus TGCCAATTGTGATTCAGGCTCCTTCTTGACAGGCTCTTCTTTTTCAGACAAAGTTAACTC
 
. : . : . : . : . : . :
JMFF017C02+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
rJMFF017C02- GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
JMFN043J03+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
JMFN007O15+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
JMFN045F23+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
JMFN044G24+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
JMFN012F21+ GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
                      ____________________________________________________________
consensus GATATGGCAGGGGGATGACATATAGGGGTTAATTCTTCCATGAGCACGGTATGTGCGGCG
 
. : . : . : . : . : . :
JMFF017C02+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
rJMFF017C02- TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
JMFN043J03+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
JMFN007O15+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
JMFN045F23+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
JMFN044G24+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
JMFN012F21+ TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
                      ____________________________________________________________
consensus TCGTTGCTTCTGAGCTTGGTTTACCTGAATGTGGGATATGAAAAGTGAATCCACATCCAA
 
. : . : . : . : . : . :
JMFF017C02+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
rJMFF017C02- GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
JMFN043J03+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
JMFN007O15+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
JMFN045F23+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
JMFN044G24+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
JMFN012F21+ GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
                      ____________________________________________________________
consensus GCCTTTAACTTCGGCATTGCTCTCAGCATTCTTGAGCAAATCCAGAATAAACCTAGCTGA
 
. : . : . : . : . : . :
JMFF017C02+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
rJMFF017C02- TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
JMFN043J03+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
JMFN007O15+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
JMFN045F23+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
JMFN044G24+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
JMFN012F21+ TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
                      ____________________________________________________________
consensus TTTCACAGGCCAACGTCCTTGTCCATTTGGATGCCTGTTCTTTGCCTGAGCAGTTCTTCC
 
. : . : . : . : . : . :
JMFF017C02+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
rJMFF017C02- AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
JMFN043J03+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
JMFN007O15+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
JMFN045F23+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
JMFN044G24+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
JMFN012F21+ AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
                      ____________________________________________________________
consensus AACACCTCTGCAGAAGCGAGTGAAGGGAATGGCTTGCTTGTGGACCAAAACATCCTCCAA
 
. : . : . : . : . : . :
JMFF017C02+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
rJMFF017C02- GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
JMFN043J03+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
JMFN007O15+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
JMFN045F23+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
JMFN044G24+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
JMFN012F21+ GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
                      ____________________________________________________________
consensus GTACCTTTTAGCCTTTGTTAAAGGCAGCTTCCTGATAGCATGCGCTGTTTCCCTTGTGTT
 
. : . : . : . : . : . :
JMFF017C02+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
rJMFF017C02- CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
JMFN043J03+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
JMFN007O15+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
JMFN045F23+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
JMFN044G24+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
JMFN012F21+ CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
                      ____________________________________________________________
consensus CTTAAAATGAACTCTAAGATCAGAACCCCTGGCTTTGCAGGATTTTGTGGGATTGTCGGG
 
. : . : . : . : . : . :
JMFF017C02+ CTCTCTTGAGTACTTCACCATGGCG
rJMFF017C02- CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGG
JMFN043J03+ CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAG
JMFN007O15+ CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAGGTCC
JMFN045F23+ CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAGGTCCG
JMFN044G24+ CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAGGTCCG
JMFN012F21+ CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAGGTCCG
                      ____________________________________________________________
consensus CTCTCTTGAGTACTTCACCATGGCGATTGATGATCCTCTTCCAGGAAGTGCTTAGGTCCG