Previous Contig 002410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008J14Sequence639002410 (2)gb:AY085486_15705558e-25Arabidopsis thaliana clone 153811 mRNA, complete sequence.
JMFN012F14Sequence535002410 (2)gb:AY085486_15705557e-25Arabidopsis thaliana clone 153811 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008J14- ATCCCCCACCCCCTGA
                      ____________________________________________________________
consensus ATCCCCCACCCCCTGA
 
. : . : . : . : . : . :
JMFN008J14- ATTGGATATATATATATAATCTCGGGTTGAAGTTTACTACTGGGTTGGAGAGAAATTTGA
                      ____________________________________________________________
consensus ATTGGATATATATATATAATCTCGGGTTGAAGTTTACTACTGGGTTGGAGAGAAATTTGA
 
. : . : . : . : . : . :
JMFN008J14- ATAATGGCTCACCTCCAGTTGTTGAAATATAGTGTGTCGTCATTTTTGAGTTCTCATACA
                      ____________________________________________________________
consensus ATAATGGCTCACCTCCAGTTGTTGAAATATAGTGTGTCGTCATTTTTGAGTTCTCATACA
 
. : . : . : . : . : . :
JMFN008J14- AAATTGGCGTGCAGTTGCTCGGATTTCAGCTCGGGGATCATAGGATATAGAAGAAGGAGA
                      ____________________________________________________________
consensus AAATTGGCGTGCAGTTGCTCGGATTTCAGCTCGGGGATCATAGGATATAGAAGAAGGAGA
 
. : . : . : . : . : . :
JMFN008J14- AGGAATTTTCGGTTTCAAAGCAAGCGGAATCGGAGCTTCAGATTATTGATTGATCGGAAG
                      ____________________________________________________________
consensus AGGAATTTTCGGTTTCAAAGCAAGCGGAATCGGAGCTTCAGATTATTGATTGATCGGAAG
 
. : . : . : . : . : . :
JMFN008J14- CTTAGGGTTTCATGCAGAACTCAGGACAACGATACTCCAAGCAATGGTGAAGAACCTCCT
                      ____________________________________________________________
consensus CTTAGGGTTTCATGCAGAACTCAGGACAACGATACTCCAAGCAATGGTGAAGAACCTCCT
 
. : . : . : . : . : . :
JMFN008J14- GAGTCGTTGTTTATGAAAGAATTGAAGAAACGAGGCATGACTCCTACTTCATTACTTGAA
                      ____________________________________________________________
consensus GAGTCGTTGTTTATGAAAGAATTGAAGAAACGAGGCATGACTCCTACTTCATTACTTGAA
 
. : . : . : . : . : . :
JMFN008J14- GAAAGCAACAGAAGCATCTTGGAGGATGAAGAAACAAAAATTAAGGAAGAAGATGGAGGC
                      ____________________________________________________________
consensus GAAAGCAACAGAAGCATCTTGGAGGATGAAGAAACAAAAATTAAGGAAGAAGATGGAGGC
 
. : . : . : . : . : . :
JMFN008J14- TTTTCTCGTAGAAATGCCATCTCGACGGAATCAGGAAGAAACTTAACTAATCAGAGAGAG
JMFN012F14+ TCGTAGAAATGCCATCTCGACGGAATCAGGAAGAAACTTAACTAATCAGAGAGAG
                      ____________________________________________________________
consensus TTTTCTCGTAGAAATGCCATCTCGACGGAATCAGGAAGAAACTTAACTAATCAGAGAGAG
 
. : . : . : . : . : . :
JMFN008J14- CAGTCCATGGCCCTTAATAGTGAAGGCATTGAGGGCTTAATTCCACGGGCTAAGCTTTTG
JMFN012F14+ CAGTCCATGGCCCTTAATAGTGAAGGCATTGAGGGCTTAATTCCACGGGCTAAGCTTTTG
                      ____________________________________________________________
consensus CAGTCCATGGCCCTTAATAGTGAAGGCATTGAGGGCTTAATTCCACGGGCTAAGCTTTTG
 
. : . : . : . : . : . :
JMFN008J14- CTGACCCTTGGAGGGACGTTCTTTCTGGGATTCGGGCCACTAATCCTAGTAACCGTTGCA
JMFN012F14+ CTGACCCTTGGAGGGACGTTCTTTCTGGGATTCGGGCCACTAATCCTAGTAACCGTTGCA
                      ____________________________________________________________
consensus CTGACCCTTGGAGGGACGTTCTTTCTGGGATTCGGGCCACTAATCCTAGTAACCGTTGCA
 
. : . : . : . : . : . :
JMFN008J14- TTTTTCTCTGCTTTGTACCTGTA
JMFN012F14+ TTTTTCTCTGCTTTGTACCTGTATTTCGGACCCACATTTATCCATGACGGAAGCAATGCT
                      ____________________________________________________________
consensus TTTTTCTCTGCTTTGTACCTGTATTTCGGACCCACATTTATCCATGACGGAAGCAATGCT
 
. : . : . : . : . : . :
JMFN012F14+ CGCATCACTCCACCGCAATATGTTGATCCCTATGCACTACTCGAAGACGAAAGGATATCC
                      ____________________________________________________________
consensus CGCATCACTCCACCGCAATATGTTGATCCCTATGCACTACTCGAAGACGAAAGGATATCC
 
. : . : . : . : . : . :
JMFN012F14+ CAAACTGCACCTGGTCTAAACTGAAGAACTCTGCTTCAAATGTCAAGTACATGTTTGTTT
                      ____________________________________________________________
consensus CAAACTGCACCTGGTCTAAACTGAAGAACTCTGCTTCAAATGTCAAGTACATGTTTGTTT
 
. : . : . : . : . : . :
JMFN012F14+ CACATATATATACTCTTCGACTTAATGTTGTGATCTAGTTAGGAAGTAGGTAGGAATTTC
                      ____________________________________________________________
consensus CACATATATATACTCTTCGACTTAATGTTGTGATCTAGTTAGGAAGTAGGTAGGAATTTC
 
. : . : . : . : . : . :
JMFN012F14+ CGACTACTAGGTTAAAGTTTTCTTTGATCTACCAATGTAAAATATGTATGTACTCAATTC
                      ____________________________________________________________
consensus CGACTACTAGGTTAAAGTTTTCTTTGATCTACCAATGTAAAATATGTATGTACTCAATTC
 
. : . : . : . : . : . :
JMFN012F14+ CCCTGAAAGAAGATTTCAAATGXXXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus CCCTGAAAGAAGATTTCAAATGNNNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC