Previous Contig 002407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN012D24Sequence626002407 (3)gb:AY429440_16058438e-59Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFN045C09Sequence619002407 (3)gb:AY429440_16058431e-40Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFS163F11Sequence590002407 (3)gb:AY429440_16058437e-59Gossypium barbadense fiber protein Fb19 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163F11+ TCAAGGCATTATATTGATTGATACATACACCAA
JMFN012D24+ TTGATACATACACCAA
                      ____________________________________________________________
consensus TCAAGGCATTATATTGATTGATACATACACCAA
 
. : . : . : . : . : . :
JMFS163F11+ GCAATTCACATAGATAGACAGACAGAGAGACAATGGTTTATGTAATCTGGAACAGAAATT
JMFN012D24+ GCAATTCACATAGATAGACAGACAGAGAGACAATGGTTTATGTAATCTGGAACAGAAATT
                      ____________________________________________________________
consensus GCAATTCACATAGATAGACAGACAGAGAGACAATGGTTTATGTAATCTGGAACAGAAATT
 
. : . : . : . : . : . :
JMFS163F11+ ATGGACTCATATGATGTCTGCAACTAATTAGGTTTTGTGCTTTGGCTTCTTCACGATCAT
JMFN045C09+ GTTTTGTGCTTTGGCTTCTTCACGATCAT
JMFN012D24+ ATGGACTCATATGATGTCTGCAACTAATTAGGTTTTGTGCTTTGGCTTCTTCACGATCAT
                      ____________________________________________________________
consensus ATGGACTCATATGATGTCTGCAACTAATTAGGTTTTGTGCTTTGGCTTCTTCACGATCAT
 
. : . : . : . : . : . :
JMFS163F11+ GACAGTGCAGTGAGCATGATGAGCGCAGTAGTCGCTTACACTGCCCAGAACAGCCCTCTT
JMFN045C09+ GACAGTGCAGTGAGCATGATGAGCGCAGTAGTCGCTTACACTGCCCAGAACAGCCCTCTT
JMFN012D24+ GACAGTGCAGTGAGCATGATGAGCGCAGTAGTCGCTTACACTGCCCAGAACAGCCCTCTT
                      ____________________________________________________________
consensus GACAGTGCAGTGAGCATGATGAGCGCAGTAGTCGCTTACACTGCCCAGAACAGCCCTCTT
 
. : . : . : . : . : . :
JMFS163F11+ GATAGCTCCATAGCCATGGCTGCCGACAACCAAGATAGAGGCATGGTGTTTCTCCACAGT
JMFN045C09+ GATAGCTCCATAGCCATGGCTGCCGACAACCAAGATAGAGGCATGGTGTTTCTCCACAGT
JMFN012D24+ GATAGCTCCATAGCCATGGCTGCCGACAACCAAGATAGAGGCATGGTGTTTCTCCACAGT
                      ____________________________________________________________
consensus GATAGCTCCATAGCCATGGCTGCCGACAACCAAGATAGAGGCATGGTGTTTCTCCACAGT
 
. : . : . : . : . : . :
JMFS163F11+ TTCGCAGAGGACATTCCTGGCATCCCCTTCCATGATCTCGAACATGGGGTCATCAACCGA
JMFN045C09+ TTCGCAGAGGACATTCCTGGCATCCCCTTCCATGATCTCGAACATGGGGTCATCAACCGA
JMFN012D24+ TTCGCAGAGGACATTCCTGGCATCCCCTTCCATGATCTCGAACATGGGGTCATCAACCGA
                      ____________________________________________________________
consensus TTCGCAGAGGACATTCCTGGCATCCCCTTCCATGATCTCGAACATGGGGTCATCAACCGA
 
. : . : . : . : . : . :
JMFS163F11+ TTTAGAGGCGCAGATTTCCTTGGCCCGTTCAATAACCCGCGCAGCAATCTTCTTCAAGTC
JMFN045C09+ TTTAGAGGCGCAGATTTCCTTGGCCCGTTCAATAACCCGCGCAGCAATCTTCTTCAAGTC
JMFN012D24+ TTTAGAGGCGCAGATTTCCTTGGCCCGTTCAATAACCCGCGCAGCAATCTTCTTCAAGTC
                      ____________________________________________________________
consensus TTTAGAGGCGCAGATTTCCTTGGCCCGTTCAATAACCCGCGCAGCAATCTTCTTCAAGTC
 
. : . : . : . : . : . :
JMFS163F11+ CGAATCCACATGTGGCAAGATATCAGCAGCGCCGGGCCCGGCGAGGCTGACGGCGTTAGC
JMFN045C09+ CGAATCCACATGTGGCAAGATATCAGCAGCGCC
JMFN012D24+ CGAATCCACATGTGGCAAGATATCAGCAGCGCCGGGCCCGGCGAGGCTGACGGCGTTAGC
                      ____________________________________________________________
consensus CGAATCCACATGTGGCAAGATATCAGCAGCGCCGGGCCCGGCGAGGCTGACGGCGTTAGC
 
. : . : . : . : . : . :
JMFS163F11+ CGGAGAAGGCTTGGCGTGGACGAGGACGAGCCTGAAAGTCGACACGGGGCCGGTGAAGAA
JMFN012D24+ CGGAGAAGGCTTGGCGTGGACGAGGACGAGCCTGAAAGTCGACACGGGGCCGGTGAAGAA
                      ____________________________________________________________
consensus CGGAGAAGGCTTGGCGTGGACGAGGACGAGCCTGAAAGTCGACACGGGGCCGGTGAAGAA
 
. : . : . : . : . : . :
JMFS163F11+ GTGATCTAAAGTCCATCCCAGAGCATAGAAGCTATGTTCGCTATCGTCAACCGCAACCAC
JMFN012D24+ GTGATCTAAAGTCCATCCCAGAGCATAGAAGCTATGTTCGCTATCGTCAACCGCAACCAC
                      ____________________________________________________________
consensus GTGATCTAAAGTCCATCCCAGAGCATAGAAGCTATGTTCGCTATCGTCAACCGCAACCAC
 
. : . : . : . : . : . :
JMFS163F11+ CATAACCGGTTTCTCCG
JMFN012D24+ CATAACCGGTTTCTCCGCCGCCGCCGCCATTCTCAACCACTTTACGTGTCCGGTGAAGTT
                      ____________________________________________________________
consensus CATAACCGGTTTCTCCGCCGCCGCCGCCATTCTCAACCACTTTACGTGTCCGGTGAAGTT