Previous Contig 002406:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022L01Sequence724002406 (7)gb:AY324112_15993839e-72Brassica napus adenine phosphoribosyltransferase mRNA, partial cds.
JMFF025H05Sequence588002406 (7)sp|P31166|APT1_ARATH6e-71Adenine phosphoribosyltransferase 1 (EC 2.4.2.7) (APRT).>gb:AY084300_1569392 Ara756002406 (7)gb:AY324112_15993831e-72Brassica napus adenine phosphoribosyltransferase mRNA, partial cds.
JMFF037B22Sequence195002406 (7)731002406 (7)gb:AY324112_15993837e-61Brassica napus adenine phosphoribosyltransferase mRNA, partial cds.
JMFN012D20Sequence642002406 (7)sp|P31166|APT1_ARATH2e-60Adenine phosphoribosyltransferase 1 (EC 2.4.2.7) (APRT).>gb:AY084300_1569392 Ara
JMFN040F03Sequence615002406 (7)sp|P31166|APT1_ARATH8e-72Adenine phosphoribosyltransferase 1 (EC 2.4.2.7) (APRT).>gb:AY084300_1569392 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037B22- AATTTATCCGATTAGAAGATGAGAAGTATTCAAGTTGTAAGTAGTGAAATAGGAAAGTT
rJMFF025H05- TTGTAAGTAGTGAAATAGGAAAGTT
                      ____________________________________________________________
consensus AATTTATCCGATTAGAAGATGAGAAGTATTCAAGTTGTAAGTAGTGAAATAGGAAAGTT
 
. : . : . : . : . : . :
rJMFF037B22- GATGATCACACATAAATAAGATGTCTCGTGTTATACTATGCAACAATCCAACTAAAACAA
rJMFF022L01- TAAATAAGATGTCTCGTGTTATACTATGCAACAATCCAACTAAAACAA
rJMFF025H05- GATGATCACACATAAATAAGATGTCTCGTGTTATACTATGCAACAATCCAACTAAAACAA
                      ____________________________________________________________
consensus GATGATCACACATAAATAAGATGTCTCGTGTTATACTATGCAACAATCCAACTAAAACAA
 
. : . : . : . : . : . :
rJMFF037B22- CAACCTTTAAAGCTTATTACAATCAACTGATCAAAGCCAGGATTCAATTTTCTGCTGTTA
rJMFF022L01- CAACCTTTAAAGCTTATTACAATCAACTGATCAAAGCCAGGATTCAATTTTCTGCTGTTA
rJMFF025H05- CAACCTTTAAAGCTTATTACAATCAACTGATCAAAGCCAGGATTCAATTTTCTGCTGTTA
                      ____________________________________________________________
consensus CAACCTTTAAAGCTTATTACAATCAACTGATCAAAGCCAGGATTCAATTTTCTGCTGTTA
 
. : . : . : . : . : . :
rJMFF037B22- TTATAAGAAGATAAGATTGTTAAGATCTCTCTTGAATGGGAACCAACCAACTTGAGCATG
rJMFF022L01- TTATAAGAAGATAAGATTGTTAAGATCTCTCTTGAATGGGAACCAACCAACTTGAGCATG
rJMFF025H05- TTATAAGAAGATAAGATTGTTAAGATCTCTCTTGAATGGGAACCAACCAACTTGAGCATG
                      ____________________________________________________________
consensus TTATAAGAAGATAAGATTGTTAAGATCTCTCTTGAATGGGAACCAACCAACTTGAGCATG
 
. : . : . : . : . : . :
rJMFF037B22- CTTGCTTTCCCACTGCTCACATGTCAAACTGTAACTCCACATTCCACGTATGCTACGTTT
rJMFF022L01- CTTGCTTTCCCACTGCTCACATGTCAAACTGTAACTCCACATTCCACGTATGCTACGTTT
rJMFF025H05- CTTGCTTTCCCACTGCTCACATGTCAAACTGTAACTCCACATTCCACGTATGCTACGTTT
                      ____________________________________________________________
consensus CTTGCTTTCCCACTGCTCACATGTCAAACTGTAACTCCACATTCCACGTATGCTACGTTT
 
. : . : . : . : . : . :
rJMFF037B22- CATGATCAAGTTGAGCTCACAAGAACAAACAGTGGTTTGTCTCCTAACCGCGCCCGCCCC
rJMFF022L01- CATGATCAAGTTGAGCTCACAAGAACAAACAGTGGTTTGTCTCCTAACCGCGCCCGCCCC
rJMFF025H05- CATGATCAAGTTGAGCTCACAAGAACAAACAGTGGTTTGTCTCCTAACCGCGCCCGCCCC
                      ____________________________________________________________
consensus CATGATCAAGTTGAGCTCACAAGAACAAACAGTGGTTTGTCTCCTAACCGCGCCCGCCCC
 
. : . : . : . : . : . :
rJMFF037B22- TTCAGTTCTGGCAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
rJMFF022L01- TTCAGTTCTGGCAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
rJMFF025H05- TTCAGTTCTGGCAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
JMFF025H05+ CAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
JMFN040F03+ CAGTTCTGGCAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
                      ____________________________________________________________
consensus TTCAGTTCTGGCAATTCAATAACACATGCACACTCAACCACAGTGCCGCCAACACGCTCA
 
. : . : . : . : . : . :
rJMFF037B22- ATTAGCCTGATTGCAGCACCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
rJMFF022L01- ATTAGCCTGATTGCAGCANCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
rJMFF025H05- ATTAGCCTGATTGCAGCACCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
JMFF025H05+ ATTAGCCTGATTGCAGCACCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
JMFN040F03+ ATTAGCCTGATTGCAGCACCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
JMFN012D20+ CCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
                      ____________________________________________________________
consensus ATTAGCCTGATTGCAGCACCCAAGGTACCCCCAGTTGCAATAAGATCATCTATTATAAGG
 
. : . : . : . : . : . :
rJMFF037B22- ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
rJMFF022L01- ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
rJMFF025H05- ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
JMFF025H05+ ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
JMFN040F03+ ACGCGTTCCCCATCTTGGACAGCACGTACATGCATCTCGATTACATCTGTTCCATACTCC
JMFN012D20+ ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
                      ____________________________________________________________
consensus ACGCGTTCCCCATCTTGGACAGCACCTACATGCATCTCGATTACATCTGTTCCATACTCC
 
. : . : . : . : . : . :
rJMFF037B22- AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
rJMFF022L01- AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
rJMFF025H05- AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
JMFF025H05+ AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
JMFN040F03+ AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
JMFN012D20+ AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
                      ____________________________________________________________
consensus AAAGAGTATTCTTCTGAGATAACCTCACCAGGTAACTTCTTGGGTTTCCTCATAGGAACA
 
. : . : . : . : . : . :
rJMFF037B22- AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
rJMFF022L01- AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
rJMFF025H05- AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
JMFF025H05+ AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
JMFN040F03+ AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
JMFN012D20+ AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
                      ____________________________________________________________
consensus AATTTTGCCCCTATAGCCAATGCTATTGGAGGGCCAAAAATAAAGCCTCTTGCTTCAATA
 
. : . : . : . : . : . :
rJMFF037B22- CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
rJMFF022L01- CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
rJMFF025H05- CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
JMFF025H05+ CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
JMFN040F03+ CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
JMFN012D20+ CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
                      ____________________________________________________________
consensus CCTGCAACCACATTGATCTTTTTGTCCTGGTATCTCTCCACAAACAAATCGATAGTGTCC
 
. : . : . : . : . : . :
rJMFF037B22- TTGAAAGCCTTG
rJMFF022L01- TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
rJMFF025H05- TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
JMFF025H05+ TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
JMFN040F03+ TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
JMFN012D20+ TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
                      ____________________________________________________________
consensus TTGAAAGCCTTGGGATCAAGCAGCAACGTCGTTATATCCTGAAACATAATCCCGGGTTTG
 
. : . : . : . : . : . :
rJMFF022L01- GGGAAGTC
rJMFF025H05- GGGAAGTCGGG
JMFF025H05+ GGGAAGTCGGGGATGACGCGAATGGCGGATGAAATCTGGGCGATTCGAGTGTCTTTGATA
JMFN040F03+ GGGAAGTCGGGGATGACGCGAATGGCGGATGAAATCTGGGCGATTCGAGTGTCTTTGATA
JMFN012D20+ GGGAAGTCGGGGATGACGCGAATGGCGGATGAAATCTGGGCGATTCGAGTGTCTTTGATA
                      ____________________________________________________________
consensus GGGAAGTCGGGGATGACGCGAATGGCGGATGAAATCTGGGCGATTCGAGTGTCTTTGATA
 
. : . : . : . : . : . :
JMFF025H05+ GCCGGATCGTGAGAAGCCATCTCCGTCAAGGTGTCCGGGTCCGATGAGACGGGTGTGGTA
JMFN040F03+ GCCGGATCGTGAGAAGCCATCTCCGTCAAGGTGTCCGGGTCCGATGAGACGGGTGTGGTA
JMFF037B22+ GGTCCGATGAGACGGGTGTGGTA
JMFN012D20+ GCCGGATCGTGAGAAGCCATCTCCGTCAAGGTGTCCGGGTCCGATGAGACGGGTGTGGTA
                      ____________________________________________________________
consensus GCCGGATCGTGAGAAGCCATCTCCGTCAAGGTGTCCGGGTCCGATGAGACGGGTGTGGTA
 
. : . : . : . : . : . :
JMFF025H05+ TCGCCTCCGGCAGACGCGTGGATTGGCTGAGCTAGCTTTGGAGTGGTGGTGGCGGCGGC
JMFN040F03+ TCGCCTCCGGCAGACGCGTGGATTGGCTGAGCTAGCTTTGGAGTGGTGGTGGCGGCGGCG
JMFF037B22+ TCGCCTCCGGCAGACGCGTGGATTGGCTGAGCTAGCTTTGGAGTGGTGGTGGCGGCGGCG
JMFN012D20+ TCGCCTCCGGCAGACGCGTGGATTGGCTGAGCTAGCTTTGGAGTGGTGGTGGCGGCGGCG
                      ____________________________________________________________
consensus TCGCCTCCGGCAGACGCGTGGATTGGCTGAGCTAGCTTTGGAGTGGTGGTGGCGGCGGCG
 
. : . : . : . : . : . :
JMFN040F03+ GAGAAGGAGGCAGTTGT
JMFF037B22+ GAGAAGGAGGCAGTTGTGTTAGGTAACTTTATTCGGACTAAATTGCCACCTTGAAAATAT
JMFN012D20+ GAGAAGGAGGCAGTTGTGTTAGGTAACTTTATTCGGACTAAATTGCCACCTTGAAAATAT
                      ____________________________________________________________
consensus GAGAAGGAGGCAGTTGTGTTAGGTAACTTTATTCGGACTAAATTGCCACCTTGAAAATAT
 
. : . : . : . : . : . :
JMFF037B22+ CTTGGTAACTTTTTTCGGCCAAAATTGCCCTCCCTGAGTCTGAGAGCCAATT
JMFN012D20+ CTTGGTAACTTTTTTCGGCCAAAATTGCCCTCCCTGAGTCTGAGAGCCAATTGGTGGGTG
                      ____________________________________________________________
consensus CTTGGTAACTTTTTTCGGCCAAAATTGCCCTCCCTGAGTCTGAGAGCCAATTGGTGGGTG