Previous Contig 002404:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN012B24Sequence622002404 (4)pir|G96547|G965478e-43probable histone H2A [imported] - Arabidopsis thaliana>gb:AE005173_893019 Arabid
JMFN029P11Sequence525002404 (4)gb:AP003838_18340443e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ15
JMSF022M04Sequence668002404 (4)pir|G96547|G965479e-43probable histone H2A [imported] - Arabidopsis thaliana>gb:AE005173_893019 Arabid616002404 (4)pir|G96547|G965478e-43probable histone H2A [imported] - Arabidopsis thaliana>gb:AE005173_893019 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012B24- TCTCTCTAGACTAGAAATAGCT
                      ____________________________________________________________
consensus TCTCTCTAGACTAGAAATAGCT
 
. : . : . : . : . : . :
JMFN012B24- CACCGATTAAAGCTTCTCTTTCTCGATCTTTGCCGCCTGAATATCTAAAGAGATGGCCGG
                      ____________________________________________________________
consensus CACCGATTAAAGCTTCTCTTTCTCGATCTTTGCCGCCTGAATATCTAAAGAGATGGCCGG
 
. : . : . : . : . : . :
JMFN012B24- CCGTGGAAAGACTCTTGGTTCCGGAGCTGCGAAGAAGGCTCAGTCACGTAGCAGCAAAGC
                      ____________________________________________________________
consensus CCGTGGAAAGACTCTTGGTTCCGGAGCTGCGAAGAAGGCTCAGTCACGTAGCAGCAAAGC
 
. : . : . : . : . : . :
JMFN029P11+ CGGGCTCCAGTTCCCCGTCGGTCGTATTGCCCGTTTTCTCAAGGCCGGCAAGTACGCCGA
JMFN012B24- CGGGCTCCAGTTCCCCGTCGGTCGTATTGCCCGTTTTCTCAAGGCCGGCAAGTACGCCGA
                      ____________________________________________________________
consensus CGGGCTCCAGTTCCCCGTCGGTCGTATTGCCCGTTTTCTCAAGGCCGGCAAGTACGCCGA
 
. : . : . : . : . : . :
rJMSF022M04+ CCGGTGCTCCCGTCTATCTCGCCGCCGTGCTCGAATATCTTGCCGCCGA
JMFN029P11+ GCGTGTTGGAGCCGGTGCTCCCGTCTATCTCGCCGCCGTGCTCGAATATCTTGCCGCCGA
JMSF022M04- CCGGTGCTCCCGTCTATCTCGCCGCCGTGCTCGAATATCTTGCCGCCGA
JMFN012B24- GCGTGTTGGAGCCGGTGCTCCCGTCTATCTCGCCGCCGTGCTCGAATATCTTGCCGCCGA
                      ____________________________________________________________
consensus GCGTGTTGGAGCCGGTGCTCCCGTCTATCTCGCCGCCGTGCTCGAATATCTTGCCGCCGA
 
. : . : . : . : . : . :
rJMSF022M04+ GGTCCTGGAATTGGCCGGAAACGCAGCTCGGGACAACAAGAAGACGAGGATTGTGCCGAG
JMFN029P11+ GGTCCTGGAATTGGCCGGAAACGCAGCTCGGGACAACAAGAAGACGAGGATTGTGCCGAG
JMSF022M04- GGTCCTGGAATTGGCCGGAAACGCAGCTCGGGACAACAAGAAGACGAGGATTGTGCCGAG
JMFN012B24- GGTCCTGGAATTGGCCGGAAACGCAGCTCGGGACAACAAGAAGACGAGGATTGTGCCGAG
                      ____________________________________________________________
consensus GGTCCTGGAATTGGCCGGAAACGCAGCTCGGGACAACAAGAAGACGAGGATTGTGCCGAG
 
. : . : . : . : . : . :
rJMSF022M04+ GCATATCCAATTGGCAGTGAGGAACGACGAGGAGCTGAGCAAACTGCTGGGGGATGTGAC
JMFN029P11+ TCATATCCAATTGGCAGTGAGGAACGACGAGGAGCTGAGCAAACTGCTGGGGGATGTGAC
JMSF022M04- GCATATCCAATTGGCAGTGAGGAACGACGAGGAGCTGAGCAAACTGCTGGGGGATGTGAC
JMFN012B24- GCATATCCAATTGGCAGTGAGGAACGACGAGGAGCTGAGCAAACTGCTGGGGGATGTGAC
                      ____________________________________________________________
consensus GCATATCCAATTGGCAGTGAGGAACGACGAGGAGCTGAGCAAACTGCTGGGGGATGTGAC
 
. : . : . : . : . : . :
rJMSF022M04+ GATAGCCAATGGCGGCGTGATGCCCAACATCCACAACCTTCTGCTCCCAAAGAAGGCCGG
JMFN029P11+ GATAGCCAATGGCGGCGTGATGCCCAACATCCACAACCTTCTGCTCCCAAAGAAGGCCGG
JMSF022M04- GATAGCCAATGGCGGCGTGATGCCCAACATCCACAACCTTCTGCTCCCAAAGAAGGCCGG
JMFN012B24- GATAGCCAATGGCGGCGTGATGCCCAACATCCACAACCTTCTGCTCCCAAAGAAGGCCGG
                      ____________________________________________________________
consensus GATAGCCAATGGCGGCGTGATGCCCAACATCCACAACCTTCTGCTCCCAAAGAAGGCCGG
 
. : . : . : . : . : . :
rJMSF022M04+ CGGGTCATCAAAGCCCGGCGCCGATGAGGATTAGACGGAGAGAGGAGGGGATTTGGTTGT
JMFN029P11+ CGGGTCATCAAAGCCCGGCGCCGATGAGGATTAGA
JMSF022M04- CGGGTCATCAAAGCCCGGCGCCGATGAGGATTAGA
JMFN012B24- CGGGTCATCAAAGCCCGGCGCCGATGAGGATTAGACGGAGAGAGGAGGGGATTTGGTTGT
                      ____________________________________________________________
consensus CGGGTCATCAAAGCCCGGCGCCGATGAGGATTAGACGGAGAGAGGAGGGGATTTGGTTGT
 
. : . : . : . : . : . :
rJMSF022M04+ TGTTTTGTGTTAGGTTAGAATCTGATTACGTAGATCCTTTGTTGTTGCTATAATTTTTAG
JMFN012B24- TGTTTTGTGTTAGGTTAGAATCTGATTACGTAGATCCTTTGTTGTTGCTATAATTTTTAG
                      ____________________________________________________________
consensus TGTTTTGTGTTAGGTTAGAATCTGATTACGTAGATCCTTTGTTGTTGCTATAATTTTTAG
 
. : . : . : . : . : . :
rJMSF022M04+ CAGGTTTTTTGTTTTGTTTTTG
JMFN012B24- CAGGTTNTTTGTTTTGTTTTTGTTTATACAAGTGAATGAATGGAAGAATGAAAAATGGAA
                      ____________________________________________________________
consensus CAGGTTTTTTGTTTTGTTTTTGTTTATACAAGTGAATGAATGGAAGAATGAAAAATGGAA