Previous Contig 002397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011P06Sequence624002397 (4)sp|P49637|R27C_ARATH4e-7460S ribosomal protein L27a-3.>pir|S71256|S71256 ribosomal protein L27a, cytosoli
JMFN038P10Sequence584002397 (4)sp|P49637|R27C_ARATH4e-7460S ribosomal protein L27a-3.>pir|S71256|S71256 ribosomal protein L27a, cytosoli
JMSF019G11Sequence446002397 (4)sp|P49637|R27C_ARATH1e-6660S ribosomal protein L27a-3.>pir|S71256|S71256 ribosomal protein L27a, cytosoli568002397 (4)sp|P49637|R27C_ARATH3e-7460S ribosomal protein L27a-3.>pir|S71256|S71256 ribosomal protein L27a, cytosoli

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011P06+ AATCATTAATATTTTTAAAGGAAA
                      ____________________________________________________________
consensus AATCATTAATATTTTTAAAGGAAA
 
. : . : . : . : . : . :
JMFN038P10+ AGAGCTGCAAAATTGAATTCCACATATAATGAAAACAAACCGCA
rJMSF019G11- AACCGCA
JMFN011P06+ TAAGCATATATTATATAGAGCTGCAAAATTGAATTCCACATATAATGAAAACAAACCGCA
                      ____________________________________________________________
consensus TAAGCATATATTATATAGAGCTGCAAAATTGAATTCCACATATAATGAAAACAAACCGCA
 
. : . : . : . : . : . :
JMFN038P10+ AGTTCATATCATAAATGTTAAGATTCCAAAACCGCAAAATGTGAGACGGAGAGTGAAAGA
rJMSF019G11- AGTTCATATCATAAATGTTAAGATTCCAAAACCGCAAAATGTGAGACGGAGAGTGAAAGA
JMFN011P06+ AGTTCATATCATAAATGTTAAGATTCCAAAACCGCAAAATGTGAGACGGAGAGTGAAAGA
                      ____________________________________________________________
consensus AGTTCATATCATAAATGTTAAGATTCCAAAACCGCAAAATGTGAGACGGAGAGTGAAAGA
 
. : . : . : . : . : . :
JMFN038P10+ AGAACCTTAGGCGGTGAGAAGAACAGCGCCGCCGGCCTCCTTGATCTTCTTCTCGGCGAT
rJMSF019G11- AGAACCTTAGGCGGTGAGAAGAACAGCGCCGCCGGCCTCCTTGATCTTCTTCTCGGCGAT
JMSF019G11+ TCGGCGAT
JMFN011P06+ AGAACCTTAGGCGGTGAGAAGAACAGCGCCGCCGGCCTCCTTGATCTTCTTCTCGGCGAT
                      ____________________________________________________________
consensus AGAACCTTAGGCGGTGAGAAGAACAGCGCCGCCGGCCTCCTTGATCTTCTTCTCGGCGAT
 
. : . : . : . : . : . :
JMFN038P10+ CTTCGAAACGAGCTTAGCCTTTACCACAACCGGCTGATTGCTAGGAAGCACGCCCTTCCC
rJMSF019G11- CTTCGAAACGAGCTTAGCCTTTACCACAACCGGCTGATTGCTAGGAAGCACGCCCTTCCC
JMSF019G11+ CTTCGAAACGAGCTTAGCCTTTACCACAACCGGCTGATTGCTAGGAAGCACGCCCTTCCC
JMFN011P06+ CTTCGAAACGAGCTTAGCCTTTACCACAACCGGCTGATTGCTAGGAAGCACGCCCTTCCC
                      ____________________________________________________________
consensus CTTCGAAACGAGCTTAGCCTTTACCACAACCGGCTGATTGCTAGGAAGCACGCCCTTCCC
 
. : . : . : . : . : . :
JMFN038P10+ GAGAACCTTGAAAAACCCTAACTGAGTCACATCGATCAAGGGAACGTCGTCCTTGGAGGC
rJMSF019G11- GAGAACCTTGAAAAACCCTAACTGAGTCACATCGATCAAGGGAACGTCGTCCTTGGAGGC
JMSF019G11+ GAGAACCTTGAAAAACCCTAACTGAGTCACATCGATCAAGGGAACGTCGTCCTTGGAGGC
JMFN011P06+ GAGAACCTTGAAAAACCCTAACTGAGTCACATCGATCAAGGGAACGTCGTCCTTGGAGGC
                      ____________________________________________________________
consensus GAGAACCTTGAAAAACCCTAACTGAGTCACATCGATCAAGGGAACGTCGTCCTTGGAGGC
 
. : . : . : . : . : . :
JMFN038P10+ CTTGGCCTTCACTTCCGGCGGCACCATTGACCAGAGCTTGTCGACGTTGACGATGGGGCA
rJMSF019G11- CTTGGCCTTCACTTCCGGCGGCACCATTGACCAGAGCTTGTCGACGTTGACGATGGGGCA
JMSF019G11+ CTTGGCCTTCACTTCCGGCGGCACCATTGACCAGAGCTTGTCGACGTTGACGATGGGGCA
JMFN011P06+ CTTGGCCTTCACTTCCGGCGGCACCATTGACCAGAGCTTGTCGACGTTGACGATGGGGCA
                      ____________________________________________________________
consensus CTTGGCCTTCACTTCCGGCGGCACCATTGACCAGAGCTTGTCGACGTTGACGATGGGGCA
 
. : . : . : . : . : . :
JMFN038P10+ GTAGAACTTGTTGCGGAGCTTGTGGAAGTACCGCATCCCGACTTTCCCGAAATACCCCGG
rJMSF019G11- GTAGAACTTGTTGCGGAGCTTGTGGAAGTACCGCATCCCGACTTTCCCGAAATACCCCGG
JMSF019G11+ GTAGAACTTGTTGCGGAGCTTGTGGAAGTACCGCATCCCGACTTTCCCGAAATACCCCGG
JMFN011P06+ GTAGAACTTGTTGCGGAGCTTGTGGAAGTACCGCATCCCGACTTTCCCGAAATACCCCGG
                      ____________________________________________________________
consensus GTAGAACTTGTTGCGGAGCTTGTGGAAGTACCGCATCCCGACTTTCCCGAAATACCCCGG
 
. : . : . : . : . : . :
JMFN038P10+ GTGATACTTGTCGAAGAGGATCCGGTGGTGGTGCATCCCTCCGGCGTTCCCGCGGCCTCC
rJMSF019G11- GTGATACTTGTCGAAGAGGATCCGGTGGTGGTGCATCCCTCCGGCGTTCCCGCGGCCTCC
JMSF019G11+ GTGATACTTGTCGAAGAGGATCCGGTGGTGGTGCATCCCTCCGGCGTTCCCGCGGCCTCC
JMFN011P06+ GTGATACTTGTCGAAGAGGATCCGGTGGTGGTGCATCCCTCCGGCGTTCCCGCGGCCTCC
                      ____________________________________________________________
consensus GTGATACTTGTCGAAGAGGATCCGGTGGTGGTGCATCCCTCCGGCGTTCCCGCGGCCTCC
 
. : . : . : . : . : . :
JMFN038P10+ CGGGTGCTTCCGGTGCTTCCCGATGCGCCCGTGCCCGGCGCTCACGTGGCCTCTCTTCTT
rJMSF019G11- CGGGTGCTTCCGGTGCTTCCCGATGCGCCCGTGCCCGGCGCTCACGTGGCCTCTCTTCTT
JMSF019G11+ CGGGTGCTTCCGGTGCTTCCCGATGCGCCCGTGCCCGGCGCTCACGTGGCCTCTCTTCTT
JMFN011P06+ CGGGTGCTTCCGGTGCTTCCCGATGCGCCCGTGCCCGGCGCTCACGTGGCCTCTCTTCTT
                      ____________________________________________________________
consensus CGGGTGCTTCCGGTGCTTCCCGATGCGCCCGTGCCCGGCGCTCACGTGGCCTCTCTTCTT
 
. : . : . : . : . : . :
JMFN038P10+ CCTATTCTTCTTGAACCTTGTCGTCATGGTTGCCGGAGATTATTGCAGAGCGGCGGCTGA
rJMSF019G11- CCTGTTCTTCTT
JMSF019G11+ CCTGTTCTTCTT
JMFN011P06+ CCTGTTCTTCTTGAACCTTGTCGTCATGGTTGCCGGAGATTATTGCAGAGCGGCGGCTGA
                      ____________________________________________________________
consensus CCTGTTCTTCTTGAACCTTGTCGTCATGGTTGCCGGAGATTATTGCAGAGCGGCGGCTGA