Previous Contig 002396:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043G24Sequence622014958gb:AY088186_15732081e-31Arabidopsis thaliana clone 4267 mRNA, complete sequence.556002396 (2)gb:AY088186_15732082e-30Arabidopsis thaliana clone 4267 mRNA, complete sequence.
JMFN011P05Sequence634002396 (2)gb:AY088186_15732082e-31Arabidopsis thaliana clone 4267 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011P05- CGAAAAATGGTGTGAGCTATCTACGGCCGCTATA
                      ____________________________________________________________
consensus CGAAAAATGGTGTGAGCTATCTACGGCCGCTATA
 
. : . : . : . : . : . :
JMFN011P05- CTCCAAAACGTACTCCGTCCCTACCGCCTTTTCCGCTAGCAAAAATACGGCGGCGCCCGC
                      ____________________________________________________________
consensus CTCCAAAACGTACTCCGTCCCTACCGCCTTTTCCGCTAGCAAAAATACGGCGGCGCCCGC
 
. : . : . : . : . : . :
JMFN011P05- AGTTTTCTCTGCGTTCGACAAAAACAATGTTGTTCTCCGTGTTTCTCGCCCTCTTTCTGC
                      ____________________________________________________________
consensus AGTTTTCTCTGCGTTCGACAAAAACAATGTTGTTCTCCGTGTTTCTCGCCCTCTTTCTGC
 
. : . : . : . : . : . :
JMFN011P05- CATGCGTCGGCATGTCCGTAGTGCTGGTGGTCTACTTCTGCTTGCTCTGGTACGCCGCCA
                      ____________________________________________________________
consensus CATGCGTCGGCATGTCCGTAGTGCTGGTGGTCTACTTCTGCTTGCTCTGGTACGCCGCCA
 
. : . : . : . : . : . :
JMFN011P05- CATACAACGCCGGCGGCGGCGGAAACGGCCAGTACGCGGTGAAGAGCACTCAGCAGACGG
                      ____________________________________________________________
consensus CATACAACGCCGGCGGCGGCGGAAACGGCCAGTACGCGGTGAAGAGCACTCAGCAGACGG
 
. : . : . : . : . : . :
rJMFF043G24+ CTCTCCGCCACGCAGCTGGAGAAGCTGCCGAAAATCACCGGGAAGGATTTGGTTCTGG
JMFN011P05- GTCTCTCCGCCACGCAGCTGGAGAAGCTGCCGAAAATCACCGGGAAGGATTTGGTTCTGG
                      ____________________________________________________________
consensus GTCTCTCCGCCACGCAGCTGGAGAAGCTGCCGAAAATCACCGGGAAGGATTTGGTTCTGG
 
. : . : . : . : . : . :
rJMFF043G24+ GGAACGATTGCGCTGTTTGCTTGGACAATATCGGGAGCGACGAACCGGCTCGGCTGGTCC
JMFN011P05- GGAACGATTGCGCTGTTTGCTTGGACAATATCGGGAGCGACGAACCGGCTCGGCTGGTCC
                      ____________________________________________________________
consensus GGAACGATTGCGCTGTTTGCTTGGACAATATCGGGAGCGACGAACCGGCTCGGCTGGTCC
 
. : . : . : . : . : . :
rJMFF043G24+ CCGGTTGCAACCACGGGTTCCATTTAGAATGCGCCGATACGTGGCTGGCAAAGCACCCGG
JMFN011P05- CCGGTTGCAACCACGGGTTCCATTTAGAATGCGCCGATACGTGGCTGGCAAAGCACCCGG
                      ____________________________________________________________
consensus CCGGTTGCAACCACGGGTTCCATTTAGAATGCGCCGATACGTGGCTGGCAAAGCACCCGG
 
. : . : . : . : . : . :
rJMFF043G24+ TTTGCCCGATTTGCAGAACCAAGCTCGGACCGGAGCTCTTCGACCCGCC
JMFN011P05- TTTGCCCGATTTGCAGAACCAAGCTCGGACCGGAGCTCTTCGACCCGCCGGAAACTAACC
                      ____________________________________________________________
consensus TTTGCCCGATTTGCAGAACCAAGCTCGGACCGGAGCTCTTCGACCCGCCGGAAACTAACC
 
. : . : . : . : . : . :
JMFN011P05- CCTGCTGAGCTGACGGGTTTCAGTTCCTGTGGGCTGTGGATAAGTTTCAGGTTATGGGTA
                      ____________________________________________________________
consensus CCTGCTGAGCTGACGGGTTTCAGTTCCTGTGGGCTGTGGATAAGTTTCAGGTTATGGGTA
 
. : . : . : . : . : . :
JMFN011P05- GTCCTATTTTCTTTATCTNTTATCTTTATTTCCGNTACTAGGAAACAAAAACCAAAAAAA
                      ____________________________________________________________
consensus GTCCTATTTTCTTTATCTNTTATCTTTATTTCCGNTACTAGGAAACAAAAACCAAAAAAA