Previous Contig 002392:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011N15Sequence476002392 (3)gb:AY362552_16026120.003Arabidopsis thaliana ceramide kinase (CERK) mRNA, CERK-acd5 allele, complete cds
JMSF029K22Sequence663006610 (2)gb:AY362552_16026128e-13Arabidopsis thaliana ceramide kinase (CERK) mRNA, CERK-acd5 allele, complete cds750002392 (3)gb:AY362552_16026124e-58Arabidopsis thaliana ceramide kinase (CERK) mRNA, CERK-acd5 allele, complete cds
JMSF049M12Sequence601006610 (2)gb:AY362552_16026122e-17Arabidopsis thaliana ceramide kinase (CERK) mRNA, CERK-acd5 allele, complete cds816002392 (3)gb:AY362552_16026127e-65Arabidopsis thaliana ceramide kinase (CERK) mRNA, CERK-acd5 allele, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049M12+ GGATGG
                      ____________________________________________________________
consensus GGATGG
 
. : . : . : . : . : . :
rJMSF049M12+ GACCTGTACGATATGATTTGCAGGAACTAAAGTGTTCCTTCGACATAGCTCGTATGAGGC
rJMSF029K22+ GC
                      ____________________________________________________________
consensus GACCTGTACGATATGATTTGCAGGAACTAAAGTGTTCCTTCGACATAGCTCGTATGAGGC
 
. : . : . : . : . : . :
rJMSF049M12+ AGAAGTTGCATATTTGGAAGTTGATTCAAAGAAAGCAAACTTGGGTGAACAGGGAGGGCT
rJMSF029K22+ AGAAGTTGCATA-TTGGAAGTTGATTCNAAGAAAGCAAACTT-GGTGAACAGGGAGGGCT
                      ____________________________________________________________
consensus AGAAGTTGCATATTTGGAAGTTGATTCAAAGAAAGCAAACTTGGGTGAACAGGGAGGGCT
 
. : . : . : . : . : . :
rJMSF049M12+ ACAAGTGTGTAGGAAAAAGTCACTTTGTAGCCTACGTAAGAAGCCCGAAAGAATAGTGTG
rJMSF029K22+ ACAAGTGTGTAGGAAAAAGTCACTTTGTAGCCTACGTAAGAAGCCCGAAAGAATAGTGTG
                      ____________________________________________________________
consensus ACAAGTGTGTAGGAAAAAGTCACTTTGTAGCCTACGTAAGAAGCCCGAAAGAATAGTGTG
 
. : . : . : . : . : . :
rJMSF049M12+ TCGTGTGAACTGCAATGTTTGTAACTTAAAAGCAGGCGAAACATCACCAAGACATGAGAT
rJMSF029K22+ TCGTGTGAACTGCAATGTTTGTAACTTAAAAGCAGGCGAAACATCACCAAGACATGAGAT
                      ____________________________________________________________
consensus TCGTGTGAACTGCAATGTTTGTAACTTAAAAGCAGGCGAAACATCACCAAGACATGAGAT
 
. : . : . : . : . : . :
rJMSF049M12+ ATCTGAAACATACTCAATGGGACCAAACTCGAAGGAATCGAGATGGTTGAAGTCCAAAGG
rJMSF029K22+ ATCTGAAACATACTCAATGGGACCAAACTCGAAGGAATCGAGATGGTTGAAGTCCAAAGG
                      ____________________________________________________________
consensus ATCTGAAACATACTCAATGGGACCAAACTCGAAGGAATCGAGATGGTTGAAGTCCAAAGG
 
. : . : . : . : . : . :
rJMSF049M12+ GCGGTTTCTAAGTATTGGTGGTGCAATAATATCTTGTCGAAACGAAAGAGCTCCTGATGG
rJMSF029K22+ GCGGTTTCTAAGTATTGGTGGTGCAATAATATCTTGTCGAAACGAAAGAGCTCCTGATGG
                      ____________________________________________________________
consensus GCGGTTTCTAAGTATTGGTGGTGCAATAATATCTTGTCGAAACGAAAGAGCTCCTGATGG
 
. : . : . : . : . : . :
rJMSF049M12+ CCTGGTGGCCGATGCACATCTTTCAGATGGTTTCTTACATCTTATATTGATCAAAGACTG
rJMSF029K22+ CCTGGTGGCCGATGCACATCTTTCAGATGGTTTCTTACATCTTATATTGATCAAAGACTG
                      ____________________________________________________________
consensus CCTGGTGGCCGATGCACATCTTTCAGATGGTTTCTTACATCTTATATTGATCAAAGACTG
 
. : . : . : . : . : . :
rJMSF049M12+ CCCTCATGCATGTTATTTATGGCATCTTACCCAGCTTGCAAAGAAGGGCGGGAATCCCTT
rJMSF029K22+ CCCTCATGCATGTTATTTATGGCATCTTACCCAGCTTGCAAAGAAGGGCGGGAATCCCTT
                      ____________________________________________________________
consensus CCCTCATGCATGTTATTTATGGCATCTTACCCAGCTTGCAAAGAAGGGCGGGAATCCCTT
 
. : . : . : . : . : . :
rJMSF049M12+ GGATTTTCAGTTCGTTGAGCACCACAAGACGACAGCTTTCACGTTCACTTCTTTTGGGAA
rJMSF029K22+ GGATTTTCAGTTCGTTGAGCACCACAAGACGACAGCTTTCACGTTCACTTCTTTTGGGAA
                      ____________________________________________________________
consensus GGATTTTCAGTTCGTTGAGCACCACAAGACGACAGCTTTCACGTTCACTTCTTTTGGGAA
 
. : . : . : . : . : . :
rJMSF049M12+ GGAGAGCGTATGGAACATAGATGGCGAGCCCTTCCAAGCGCATCAACTCTCGGCGCAAGT
rJMSF029K22+ GGAGAGCGTATGGAACATAGATGGCGAGCCCTTCCAAGCGCATCAACTCTCGGCGCAAGT
JMFN011N15- CGCATCAACTCTCGGCGCAAGT
                      ____________________________________________________________
consensus GGAGAGCGTATGGAACATAGATGGCGAGCCCTTCCAAGCGCATCAACTCTCGGCGCAAGT
 
. : . : . : . : . : . :
rJMSF049M12+ TTTCCGCGGCCTCATCACCATGTTTGCCACTGGCCCTGAAGTGTAGCCTCAGAAGGTGCA
rJMSF029K22+ TTTCCGCGGCCTCATCACCATGTTTGCCACTGGCCCTGAAGTGTAGCCTCAGAAGGTGCA
JMFN011N15- TTTCCGCGGCCTCATCACCATGTTTGCCACTGGCCCTGAAGTGTAGCCTCAGAAGGTGCA
                      ____________________________________________________________
consensus TTTCCGCGGCCTCATCACCATGTTTGCCACTGGCCCTGAAGTGTAGCCTCAGAAGGTGCA
 
. : . : . : . : . : . :
rJMSF049M12+ TATATGTTTTCTTCTTCTTTTGCAGCAAATATTATCCTGTTCTTGAAATGGATCCTCAGA
rJMSF029K22+ TATATGTTTTCTTCTTCTTTTGCAGCAAATATTATCCTGTTCTTGAAATGGATCCTCAGA
JMFN011N15- TATATGTTTTCTTCTTCTTTTGCAGCAAATATTATCCTGTTCTTGAAATAGATCCTCAGA
                      ____________________________________________________________
consensus TATATGTTTTCTTCTTCTTTTGCAGCAAATATTATCCTGTTCTTGAAATGGATCCTCAGA
 
. : . : . : . : . : . :
rJMSF049M12+ TTTGTATAGCAATTACTAAAATCCTCTCTCCTTGCTGCCACCTCCTCCCCCCATGTAATG
rJMSF029K22+ TTTGTATAGCAATTACTAAAATCCTCTCTCCTTGCTGCCACCTCCTCCCCCCATGTAATG
JMFN011N15- TTTGTATAGCAATTACTAAAATCCTCTCTCCTTGCTGCCACCTCCTCCCCCCATGTAATG
                      ____________________________________________________________
consensus TTTGTATAGCAATTACTAAAATCCTCTCTCCTTGCTGCCACCTCCTCCCCCCATGTAATG
 
. : . : . : . : . : . :
rJMSF049M12+ TATACCATTTTGATAAATTGTTGGTCAGAT
rJMSF029K22+ TATACCATTTTGATAAATTGTTGGTCAGAT
JMFN011N15- TATACCATTTTGATAAATTGTTGGTCAGATTAGAATTTTGCAATCAATATGATCTTTGCT
                      ____________________________________________________________
consensus TATACCATTTTGATAAATTGTTGGTCAGATTAGAATTTTGCAATCAATATGATCTTTGCT
 
. : . : . : . : . : . :
JMFN011N15- TTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFN011N15- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCACCC
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCC
 
. : . : . : . : . : . :
JMFN011N15- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCCAAACAAACCCCGGGGGGGGG
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAACAAACCCCGGGGGGGGG