Previous Contig 002376:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011C07Sequence625002376 (5)pir|T03803|T038039e-08tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN011M20Sequence625002376 (5)pir|T03803|T038039e-08tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN028C17Sequence630002376 (5)gb:TOBTID91_17255662e-04Nicotiana glauca X Nicotiana langsdorffii mRNA for tumor-related protein, partia
JMFN037C13Sequence594002376 (5)pir|T03803|T038038e-08tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN043M23Sequence612002376 (5)pir|T03803|T038038e-08tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028C17+ ATGATC
                      ____________________________________________________________
consensus ATGATC
 
. : . : . : . : . : . :
JMFN028C17+ CACCCAATACATAATATATATTATGTATGTTAAGGCGCTAGCTAGAAAGTGGCATGGGCG
JMFN011M20+ TGTTAAGGCGCTAGCTAGAAAGTGGCATGGGCG
                      ____________________________________________________________
consensus CACCCAATACATAATATATATTATGTATGTTAAGGCGCTAGCTAGAAAGTGGCATGGGCG
 
. : . : . : . : . : . :
JMFN028C17+ TGGGGCGTGGTGGCATTATACTTGGAGAAGGTGAACTGGAGCGGCTTAACACCAAAGCCT
JMFN011M20+ TGGGGCGTGGTGGCATTATACTTGGAGAAGGTGAACTGGAGCGGCTTAACACCAAAGCCT
JMFN043M23+ CTGGAGCGGC-TAACACCAAAGCCT
JMFN037C13+ CCAAAGCCT
JMFN011C07+ CTGGAGCGGCTTAACACCAAAGCCT
                      ____________________________________________________________
consensus TGGGGCGTGGTGGCATTATACTTGGAGAAGGTGAACTGGAGCGGCTTAACACCAAAGCCT
 
. : . : . : . : . : . :
JMFN028C17+ ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
JMFN011M20+ ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
JMFN043M23+ ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
JMFN037C13+ ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
JMFN011C07+ ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
                      ____________________________________________________________
consensus ATGCCCAAACGGTTGTATCCATTCTGCTGTATCAACCCAACGGGGTAGCAAACGGGCACG
 
. : . : . : . : . : . :
JMFN028C17+ CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
JMFN011M20+ CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
JMFN043M23+ CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
JMFN037C13+ CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
JMFN011C07+ CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
                      ____________________________________________________________
consensus CGGGGCACTGGGATTGTTACACAATAAGCGATCTTATATCCCGACCACTCTTTCTGGACC
 
. : . : . : . : . : . :
JMFN028C17+ TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
JMFN011M20+ TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
JMFN043M23+ TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
JMFN037C13+ TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
JMFN011C07+ TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
                      ____________________________________________________________
consensus TGGAATAAGGCGCCGCCGACGCCGGCGGTTGGATCTGTCGTGACGTATTTCCGGAAGACA
 
. : . : . : . : . : . :
JMFN028C17+ TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
JMFN011M20+ TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
JMFN043M23+ TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
JMFN037C13+ TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
JMFN011C07+ TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
                      ____________________________________________________________
consensus TCGACGTCAGCTAATCCCCAAAAGATCTCTTGGATACATAATAGCCCCGCGGCGGAGACA
 
. : . : . : . : . : . :
JMFN028C17+ GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
JMFN011M20+ GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
JMFN043M23+ GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
JMFN037C13+ GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
JMFN011C07+ GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
                      ____________________________________________________________
consensus GGAAACCGGACGGTGTATGAAATGCCTTCCTTGACGACGTTGCCGGCGGTGACGTTGGCG
 
. : . : . : . : . : . :
JMFN028C17+ GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
JMFN011M20+ GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
JMFN043M23+ GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
JMFN037C13+ GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
JMFN011C07+ GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
                      ____________________________________________________________
consensus GGGGTGTTAAAGATGATGGGCCAGCCCAGGATGGAGGACTTGGAGAATATGCTGCACTGA
 
. : . : . : . : . : . :
JMFN028C17+ ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
JMFN011M20+ ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
JMFN043M23+ ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
JMFN037C13+ ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
JMFN011C07+ ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
                      ____________________________________________________________
consensus ACGACGTCGTGGGAGCAACCTTTGGTTTGATTCTTGATGTCTATTAGGCATAGTCCCGGC
 
. : . : . : . : . : . :
JMFN028C17+ TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTT-AAGCTCCTTGCCT
JMFN011M20+ TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTTGAAGCTCCTTGCCT
JMFN043M23+ TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTTGAAGCTCCTTGCCT
JMFN037C13+ TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTTGAAGCTCCTTGCCT
JMFN011C07+ TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTTGAAGCTCCTTGCCT
                      ____________________________________________________________
consensus TGGAAGATGAAAACTTTGGAGAGGGCGTTGTATGGTAGCCCCAGTTGAAGCTCCTTGCCT
 
. : . : . : . : . : . :
JMFN028C17+ TCAATGT-GATC-CAGACGCCCCCGAC
JMFN011M20+ TCAATGTCGATCACAGACGCCCCCGACGCTGAAGAAGAAGAAGGAAGCTGTC
JMFN043M23+ TCAATGTCGATCACAGACGCCCCCGACGCTGAAGAAGAAGAAGGAAGCTGTCTTGATGGG
JMFN037C13+ TCAATGTCGATCACAGACGCCCCCGACGCTGAAGAAGAAGAAGGAAGCTGTCTTGATGGG
JMFN011C07+ TCAATGTCGATCACAGACGCCCCCGACGCTGAAGAAGAAGAAGGAAGCTGTCTTGATGGG
                      ____________________________________________________________
consensus TCAATGTCGATCACAGACGCCCCCGACGCTGAAGAAGAAGAAGGAAGCTGTCTTGATGGG
 
. : . : . : . : . : . :
JMFN043M23+ CTGGCAAAGGGGACGAAAGTTAAGGTGACGAAAAGGAGCAGAAGA
JMFN037C13+ AAGGCAAAGGGGACGAAAGTTAAGGTGACGAAAAGGAGCAGAAGA
JMFN011C07+ AAGGCAAAGGGGACGAAAGTTAAGGTGACGAAAAGGAGCAGAAGAGTAGCCTTCATTTTG
                      ____________________________________________________________
consensus AAGGCAAAGGGGACGAAAGTTAAGGTGACGAAAAGGAGCAGAAGAGTAGCCTTCATTTTG