Previous Contig 002367:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003A17Sequence483007334 (6)sp|P93338|GAPN_NICPL3e-61NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph709002367 (5)sp|P93338|GAPN_NICPL1e-94NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFF007B13Sequence480007334 (6)sp|P93338|GAPN_NICPL1e-60NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph672002367 (5)sp|P93338|GAPN_NICPL2e-93NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFF033J20Sequence569007334 (6)sp|P93338|GAPN_NICPL1e-78NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph666002367 (5)sp|P93338|GAPN_NICPL2e-97NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFN010G17Sequence582002367 (5)gb:AP004702_18436519e-78Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P052
JMSF040A08Sequence668007334 (6)sp|P93338|GAPN_NICPL2e-97NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph837002367 (5)sp|P93338|GAPN_NICPLe-122NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040A08+ CAC
                      ____________________________________________________________
consensus CAC
 
. : . : . : . : . : . :
rJMSF040A08+ TGGTATTGCAATCTNGAAAAAAAGCGGGGCATGGTNCCCGCTACAGATGGAGCTTGGAGG
                      ____________________________________________________________
consensus TGGTATTGCAATCTNGAAAAAAAGCGGGGCATGGTNCCCGCTACAGATGGAGCTTGGAGG
 
. : . : . : . : . : . :
rJMSF040A08+ AAAGGACGCCTGTATTGTGCTCGAGGATGCTGACATAGATTTGGCAGCAGCAAATGTTGT
                      ____________________________________________________________
consensus AAAGGACGCCTGTATTGTGCTCGAGGATGCTGACATAGATTTGGCAGCAGCAAATGTTGT
 
. : . : . : . : . : . :
rJMSF040A08+ CAAAGGAGGATTCTCTTACAGTGGTCAGAGGTGCACTGCGGTTAAGGTTGTCTTGGTGAT
rJMFF003A17+ CTTGGTGAT
                      ____________________________________________________________
consensus CAAAGGAGGATTCTCTTACAGTGGTCAGAGGTGCACTGCGGTTAAGGTTGTCTTGGTGAT
 
. : . : . : . : . : . :
rJMSF040A08+ GGAATCCGTTGCTGATACTCTCGTCGAGAAGGTGAAGGCGAAAGTGGCGAAACTAACGGT
rJMFF033J20+ TCGAGAAGGTGAAGGCGAAAGTGGCGAAACTAACGGT
rJMFF007B13+ TCGAGAAGGTGAAGGCGAAAGTGGCGAAACTAACGGT
rJMFF003A17+ GGAATCCGTTGCTGATACTCTCGTCGAGAAGGTGAAGGCGAAAGTGGCGAAACTAACGGT
                      ____________________________________________________________
consensus GGAATCCGTTGCTGATACTCTCGTCGAGAAGGTGAAGGCGAAAGTGGCGAAACTAACGGT
 
. : . : . : . : . : . :
rJMSF040A08+ TGGGGCA-CCCGAGGATGACTGTGACATCACTCCCGTCGTTTCAGAATCATCAGCGAACT
rJMFF033J20+ TGGGGCA-CCCGAGGATGACTGTGACATCACTCCCGTCGTTTCAGAATCATCAGCGAACT
rJMFF007B13+ TGGGGCACCCCGAGGATGACTGTGACATCACTCCCGTCGTTTCAGAATCATCAGCGAACT
rJMFF003A17+ TGGGGCA-CCCGAGGATGACTGTGACATCACTCCCGTCGTTTCAGAATCATCAGCGAACT
                      ____________________________________________________________
consensus TGGGGCA-CCCGAGGATGACTGTGACATCACTCCCGTCGTTTCAGAATCATCAGCGAACT
 
. : . : . : . : . : . :
rJMSF040A08+ TCATCGAGGGGTTGGTCACAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
rJMFF033J20+ TCATCGAGGGGTTGGTCACAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
rJMFF007B13+ TCATCGAGGGGTTGGTCACAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
rJMFF003A17+ TCATCGAGGGGTTGGTCACAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
JMFN010G17- CAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
                      ____________________________________________________________
consensus TCATCGAGGGGTTGGTCACAGATGCAAAAGAAAAAGGAGCCACTTTCTGCCAACCATACA
 
. : . : . : . : . : . :
rJMSF040A08+ AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
rJMFF033J20+ AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
rJMFF007B13+ AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
rJMFF003A17+ AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
JMFN010G17- AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
                      ____________________________________________________________
consensus AGAGGGAGGGCAACCTCATCTGGCCCTTGTTGCTAGACCATGTGAGGCCCGACATGAGGA
 
. : . : . : . : . : . :
rJMSF040A08+ TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
rJMFF033J20+ TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
rJMFF007B13+ TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
rJMFF003A17+ TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
JMFN010G17- TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
                      ____________________________________________________________
consensus TCGCGTGGGAGGAGCCATTCGGGCCAGTTTTGCCCGTTATCAGGATCAATTCTGTCGAAG
 
. : . : . : . : . : . :
rJMSF040A08+ AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
rJMFF033J20+ AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
rJMFF007B13+ AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
rJMFF003A17+ AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
JMFN010G17- AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
                      ____________________________________________________________
consensus AAGGAATCCACCATTGCAACGCTAGCAATTTCGGCCTCCAAGGATGTGTCTTCACGAAAG
 
. : . : . : . : . : . :
rJMSF040A08+ ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
rJMFF033J20+ ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
rJMFF007B13+ ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
rJMFF003A17+ ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
JMFN010G17- ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
                      ____________________________________________________________
consensus ACATCAACAAAGCCATACTGATCAGCGACGCCATGGAGACTGGAACCGTGCAGATAAACT
 
. : . : . : . : . : . :
rJMSF040A08+ CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
rJMFF033J20+ CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
rJMFF007B13+ CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
rJMFF003A17+ CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
JMFN010G17- CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
                      ____________________________________________________________
consensus CAGCACCAGCACGAGGACCCGATCATTTTCCTTTCCAGGGCATCAAGGACAGTGGAATTG
 
. : . : . : . : . : . :
rJMSF040A08+ GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
rJMFF033J20+ GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
rJMFF007B13+ GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
rJMFF003A17+ GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
JMFN010G17- GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
                      ____________________________________________________________
consensus GATCACAGGGCATTACAAACAGCATTAACATGATGACCAAAGTCAAGACTACTGTCATCA
 
. : . : . : . : . : . :
rJMSF040A08+ ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
rJMFF033J20+ ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
rJMFF007B13+ ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
rJMFF003A17+ ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
JMFN010G17- ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
                      ____________________________________________________________
consensus ACCTGCCAACCCCATCTTATACTATGGGCTAACATTATGCAGTTAGCATCATGGCAATAA
 
. : . : . : . : . : . :
rJMSF040A08+ AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTG
rJMFF033J20+ AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTGATTTT
rJMFF007B13+ AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTGATTTT
rJMFF003A17+ AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTGATTTT
JMFN010G17- AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTGATTTT
                      ____________________________________________________________
consensus AAGTAGCTAATAATCTGTTCTGCATTTTAGATCAAGAAACAATTTGTTTTCCCTGATTTT
 
. : . : . : . : . : . :
rJMFF033J20+ TCACCACTTTGAACCTATAATATTGCAGTG
rJMFF007B13+ TCACCACTTTGAACCTATAATATTGCAGTG
rJMFF003A17+ TCACCACTTTGAACCTATAATATTGCAGTG-TGGAA
JMFN010G17- TCACCACTTTGAACCTATAATATTGCAGTGTTGGAATGAGAATAAGTTAGGGTGTTCACT
                      ____________________________________________________________
consensus TCACCACTTTGAACCTATAATATTGCAGTGTTGGAATGAGAATAAGTTAGGGTGTTCACT