Previous Contig 002364:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007P24Sequence567002364 (6)gb:AP005441_18517957e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN008B05Sequence604002364 (6)gb:AP005441_18517958e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN010G01Sequence625002364 (6)gb:AP005441_18517958e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN029E21Sequence544002364 (6)gb:AP005441_18517956e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN040J24Sequence539002364 (6)gb:AP005441_18517956e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFN041B01Sequence566002364 (6)gb:AP005441_18517957e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008B05+ GACCAAA
                      ____________________________________________________________
consensus GACCAAA
 
. : . : . : . : . : . :
JMFN041B01+ TTAAACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
JMFN007P24+ ACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
JMFN008B05+ GACAATAAATTGATATTAAACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
JMFN040J24+ TTAAACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
JMFN029E21+ TTAAACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
JMFN010G01+ GCATCATTCAGATCTTTGGGAGAAT
                      ____________________________________________________________
consensus GACAATAAATTGATATTAAACCAATGCAAGCTCGTGCATCATTCAGATCTTTGGGAGAAT
 
. : . : . : . : . : . :
JMFN041B01+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
JMFN007P24+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
JMFN008B05+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
JMFN040J24+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
JMFN029E21+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
JMFN010G01+ AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
                      ____________________________________________________________
consensus AGAGTCATACAGACTTGTAACAAGGATTTACAAATTTTTCTGAGATTATATACAGAGAGA
 
. : . : . : . : . : . :
JMFN041B01+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
JMFN007P24+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
JMFN008B05+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
JMFN040J24+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
JMFN029E21+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
JMFN010G01+ TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
                      ____________________________________________________________
consensus TTAGGCTGTTGGCAACTTCAGAAGGATCCAAAGGTGTTCTCCCCGCTATAAGTCATGTAG
 
. : . : . : . : . : . :
JMFN041B01+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
JMFN007P24+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
JMFN008B05+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
JMFN040J24+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
JMFN029E21+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
JMFN010G01+ AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
                      ____________________________________________________________
consensus AGGAAGCCATCCTCATCCTTGTGTTCATCATAAATTGCGGACATCATAGCAGCAGTGGGA
 
. : . : . : . : . : . :
JMFN041B01+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
JMFN007P24+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
JMFN008B05+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
JMFN040J24+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
JMFN029E21+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
JMFN010G01+ GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTTTCAGCACTTAGCTTTATCCTCTTT
                      ____________________________________________________________
consensus GGAAGGATGTTCTTCACAAAGATAAAAATGGCCTTCTCAGCACTTAGCTTTATCCTCTTT
 
. : . : . : . : . : . :
JMFN041B01+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
JMFN007P24+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
JMFN008B05+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
JMFN040J24+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
JMFN029E21+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
JMFN010G01+ CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
                      ____________________________________________________________
consensus CGAACAACATACACAAATTGCCCAACAGTCAGATCAGCAGGAACAAGATACTTCTTCTTG
 
. : . : . : . : . : . :
JMFN041B01+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
JMFN007P24+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
JMFN008B05+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
JMFN040J24+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
JMFN029E21+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
JMFN010G01+ TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
                      ____________________________________________________________
consensus TCAATGTCGGGGATGTCACTCCTTTCAGCCTTCTCCACAATGACTGGAATTCTATCAGGA
 
. : . : . : . : . : . :
JMFN041B01+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
JMFN007P24+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
JMFN008B05+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
JMFN040J24+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
JMFN029E21+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
JMFN010G01+ TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
                      ____________________________________________________________
consensus TACTTCTCTCTGATGCGAGCAGCTTCTGCCTGTCTCCTCTCTAGAGGGTGTTCCAACTTG
 
. : . : . : . : . : . :
JMFN041B01+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGC
JMFN007P24+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGC
JMFN008B05+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGC
JMFN040J24+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGCAAAGCAGAGAGAAAGAG
JMFN029E21+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGCAAAGCAGAGAGAAAGAG
JMFN010G01+ AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGCTGCGAAGATCGAAGGGG
                      ____________________________________________________________
consensus AAAGAACTCTTGGCCATGGCGATCGGCGAAGGATTTGATGTGCAAAGCAGAGAGAAAGAG
 
. : . : . : . : . : . :
JMFN040J24+ AGAGAGGAA
JMFN029E21+ AGAGAGGAAAGAGAGAC
JMFN010G01+ AATTAGGGCTTGCAAAGTAAATAAAGGAAAAAAGCAGGGGAACAATAATTGGAAGTTAGA
                      ____________________________________________________________
consensus AGAGAGGAATTGGAGAGTAAATAAAGGAAAAAAGCAGGGGAACAATAATTGGAAGTTAGA
 
. : . : . : . : . : . :
JMFN010G01+ ACTCAAAAGAAAGGTCGAGAAATAGGAAGAAAAGTAAGGAATTACCAAAGCAGAGAGAAA
                      ____________________________________________________________
consensus ACTCAAAAGAAAGGTCGAGAAATAGGAAGAAAAGTAAGGAATTACCAAAGCAGAGAGAAA